Description :
From Genome Similarity Track
Location :
Scaffold_1140:5329- 7007
Transcript NameFunction/comments
Phypl_g12537hypothetical protein

Sequence
1678 bases(100 bases per row)
GCCAGCGCTGTCGGGGAAGCCGAGCGCGTTTCCGCGTGCCGTCTGAAGGAGACGTACGACGACTACGAGAATATAAAGGTGCCACGAATCTCCTCTgacg
tggaggcggcagTCTCTGGCGCATTGCGCGGAGGTGGGGCGCCCAACCTTTTCACGAAGCAGCATGTCGGGCTCGTGTTGCAGTACGCTGCGGTTGGGCT
CGTGTACGGTGTGTTGCCATCTACCATCTACCCGTTCATGCAGGTGTACCTCAACGCCAGTGGGGCGCAGGTGGTTACCACTAGCacgctggtggtgctt
ccTTGGAGCTTCAAGGTGTTTTATGGTGTTCTCTCCGATTGTTTCCCGCTGTTCGGCTACCGTCGCCGGCCGTACATGATCATTGGGTGGACAATCTgcg
tgacgatgctgcttGCCATGGGCTGCAGTCGCGTTGGGCGTCCGTACTTCCTGGATCCGTCAGATCGAGACATTTCACCCAATGACTACACGCCCGAGAT
TGAAGCAAGGTTGAACCGTGACGCGGTTTCGGGAGGTGGCATCTACGTCGTCCTCATGATGTTCGCAGCCTTCGGATACGTTTTGGCAGACGTGTGTGCC
GATGGGGTCGTGGTAGAGCTGGCACAGAGAGAGCCGATAGCGGAGCGAGGACGCACCCAGTCTACCATCTACGCTACACGAACGTTTGCAGCCACGGTGG
GTCAGATTCTGACTGGCGTCGCTTTCAACGGCGAGGAATACGGAGGCTCGTTCGACTTCTCACTCACGTTCCCGCAACTCATGGTGGTTCTTGCGGCCTG
TACAGCTCCGATTATCCCCGTGACGTGGCTTTACATTAAAGAGACTTCCAAGCCTCCAGTGAAGTTTTCCCACTACGTGAATGAGTTGTGGCAAGCGATG
AAGACGCGTGCAGTCTACCAGGTCGTGTTCTACTCCTTCTTCAGTGGCATCTTTGCAAACTTCTCGTTCACTGCAGGGTCTCCGATCCAGTTGTACATGG
TGGGGGTCACGCCAATCAACAACACTATCAGCGACATCATCGGCAACGCCGTCTTCCTGGGCGGCATCATTCTCACGGGCAAGTACGGACTGGACTGGAA
CTGGCGCACGATGACGGTGCTCACAGGTGTTGCGGTAATCGCTGTTGATGCTGTGTGCACCTTCATCACCGTGTGGGACGTCTTCCGGTCTCAATGGTTC
TGGCTGGGGTTGCCCATAGCTGTAAACGTTCCAGCAGGCGTCAGCTTCCTCATCGGCACGTTCGTGACCGTGGAGCTTGTAGGCGAAGGACACGAAGGCG
CCATGTACGGTCTGCTTACGACCGTCGCAAACCTCTCGTCTCCCTTTGCAACCACGCTGACCAaagtcgtcgacggcagcttgtGGGACCTGAGCAATGA
GCGAGTGCAagtcgatgacgacgctgtgCGTCGTGACATCACTGATGCGGTGTTGTTCATGTACGGGATGAGCGCAGTGTCGTGGCTCTTCCTTTTCCTA
CTGCCTCGGCAGAAGCAGGATACACAGGAACTGAAGCAACGCGGTGGGTCGAGCGCCGTCTTTGGCGCGTTGACTGTGGGGTATCTTGTTGTCGCTTTGA
TCTGGTCGGTCACGACGAATATCTTGGGAATATTCCCGGGTACGAGCTGTCTCGTGGTCGCTGGCGGAAGCGGATGTT