Description :
From Genome Similarity Track
Location :
Scaffold_144:5328- 6539
Transcript NameFunction/comments
Phyke_g5008conserved hypothetical protein

Sequence
1211 bases(100 bases per row)
GAGTTGGTTTGGTCGGCTATTAAATGGCAGGGTTCCGGTGGATGTACGGCAAATTGCTGGGGTTTGTCTTGATCTGCATGCGAATTCCTTGTTCCTCATC
AATAGTCACAACACGAGGTGCGAGTGGGGTGCTGCAGCCTGCTTCCGATGGGGTTGAAGTCCCTAATCCATTGGTGAGTAGTTTGGCTTCGACACGCTTC
GTCATCGCCGCAACTGATCGGACTGAGTGCACTGACCGAATGGACTTGCATTCCGACAGTACGCTGCTCGCAACGCTCatggcatcgtcgtcatATTCCT
TAGCACCTGCGCGGTCCCATCCTAGCCGTGCCAGGTCGTCCCCGTTGAGAGCGCCGCCACCATTTGCGATCTCTTCAAACCGCTGCTGTTCGCGCTCATA
GCGCTTTTCCTCAGCGTCCTCATAGTTGACGATGGATTGAACCTGCgccatctgctgctcaacTTGCGCGACGCGCGCTTTGagctccacatcgtccaTG
AACTGGTCAATGTCCAAGTTATTGGCAAAGTCGATGAGATCATTGGCTTCATAGTCCTCCAAAGTCTCGAGTTTCTCCTCAGCTGTGGCCTTTGTAAGCG
CCCACATGGGTCGGTTCAAGTTCTTCTTTCTGTCGGCAGGCCTGGCTTCAGCGTCATAGTCTTTGCtatcgtcgtcattgttACCTCGAACTGTTTCCCG
CATTTTGGCTTCACGTTGTGAGAACCGTTCTCGACGCCTTTGAGCagcctcttcgtcctctgcCAGTGCTTCCTGCAGTCGAGAGCGCTCCTTTTGTAGg
tcatgcagccacttcttGTGTTTCGACATCGCTGTGTTTTTCTTGTCGCGACGAATTGAGCGCTGCGTTTGAACAGGACGTTCACAAGGACGATGAATGC
GGGTTACTTTGATACGCAGCGACAACCACTAGAGCAAGACTTACCCCAGACTCACTGAAAATTGGCACGTTTAGTCCCAATGGTTCACCGGGGTTACCCG
CCAGGAATGCTGCCTTGCTGTTGTCCACGACATTGTTGTTGGACTTGGTGCCACTACGATTTTCTTTGGCTAGAGCTGCGAAgatcaacagcagtacatC
GGGTGAGGAAGGACTCAAACAACCGACTTCTACATCACTTACAGCTGGAGACTCCGTTGAATGGTCGATTACAAAGCATGACGCCCTTGTAGTTGCCGAT
ACTCACAGCCG