Description :
From Genome Similarity Track
Location :
scaffold_5:532776- 539924
Transcript NameFunction/comments
g8202.t1hypothetical protein

Sequence
7148 bases(100 bases per row)
ACATGGGCAACGCGCTGCTGGTCGCGTCCGTCAAGGACCGCCAGGCGGTGGCACTGGCCGATGCCATCCTCCCCTTTGACAACCTGCGGCTGCGCGAGAT
CGAGGCGTTCTGGCGCGCGTTCTACGACTCGGCGACGAGCTTCGCGCTGTCCAGGAGCCAATTGCGCTCCATCTGCTGCCGCGCAGTGGCCACAGGCGTC
TCGAGTTTGCAGGGATCGAACTCTCGCATCGCCGAGTATGCTGACGCTGCCTTTGAACTATTTGCAGATCCTTTTATGCAGAGAAGGTGGCAGCCAGGGG
CTAGAGGGATGCACAGCCAGCAATTTTCAGCTTCCAGCGATAGTTTGGCGGCAATTGACGCCCTCGAATTCCTTTCGGCTATTGCGTTCATTGCTGCAAT
TCCGCTGGATGAGAAGATCGATTTGCTGTTTGATTCGTGGGATATGTCGGAGGACGGAGCGCTGGACTTAGATGAGTTCACGATCTCATTGAAGTCGACG
CTGTCGGGACTGGTCAAGATCCTTCAGCCGGTTGGCCCTAATCTTGCAGTCAGAGCGGCGAACTCGGATACGGTGGTCAATGAAGAGGAGATTGTGATGC
TGGCTGAATCGACTTTCAGAGAGATCACTACCTGTGGAGTCTCGTTGTCGAAGGAGAAGTTGCCAGCGCAGGAGACTGCCACAATCACGTGTGAGCAATT
TCGGGAATTTTGTGCTAAGAACAAGCGGGCAAAGGAACTTTTCGACTTGTTTGATGTTGCAGATGCTAGCCCGGAGAAACGTGGGATAGAAGCTGGAGAC
CGGGAGGATTCAATGGAGAGTACTGAAATTACGCTAGTGGCCAAGCTTGAAAAGCACTCAGTGTCGTCGGACTCATCAATAGTCGTGGATACACCGATGG
ATGTTATGCTTGATGACGTCGGTGATATGTTTCTAGCAGTAAAGCCGTGGATAGGAGCAATTGTACCCCCAAGCAAGGTCCCCCCGATTTCTAGAGGAGC
CCCACTGATCTCAGTCCAGCTAGACTGGGTATTTGGATACAGCGCGCAAGACTGCAAAAACAACGTGCGCTTTGCTTCAACAACGGCCGGTGGCAGAGCT
GGACGCTCCGAAGAGATTGTATACCCAGCTGCAGCAACATGCGTTGTGCTCAACACAAAATCCATGACTCAGCGTCACCATCTAGCTCATACAGACGATG
TGTTGAGTTTATGTCTGCATCCCCGCCTTCCCTTGGCTGCAAGTGGTGAAATCGGCAAGCAACCTAAGATTATTGTGTGGGATTTAGACACAATGGAGAC
CCAATGCATTTTGCAAGGGTTTCACAAGCGCGGTATCTTACAATTAGCCTTCCTGGCGCCTGAATTGCTGGTATCAATCGGTGGAGACGATGATCACAGC
ATTGCAATCTACGAGTCATCCAGCAATTGGAACTCTGCAGTATTGAAAATTTCGGTGAGAGGTAACAAAGCGGTCCCGTTCCACCTCACTACAAACCCGA
GGACACCTAACGAGTTTGTTACGTGTGGTCAAAAGTACATCGAGTACTGGTCACTTGAAGGAAAAGAACTTGTGTCGAAGAAGGGTTTGCTGGGGAAAAA
AGGATCTCTGCAACCGTTTCCCGTGGCTCAGTATCTCGAAAATTCTGAACAGGCAGTAGTTGTCGGAACAAGTGATGGCTTTTTGTATCTCTTCCTTGCT
CGGCAATTGACATCCGTCATTAAGGCACACGAAGGAGCAGTCACTGCCTTATTTTACTCATCTGGGCTTTTGGTTTCTGGAGGACGAGATGGTCAAATCG
CTCAATGGGATGATAAGCTCAAACAAGTAGGCAACGCTTTCCAGATCCAAGATTTGCTTGAATCAACTTCACTGTCTGAGCGCAAGGGAATTCGAAGTTG
TTGTTATTCGCCTGATAGACGAACTATCGTCGTTGGGACACTAGCGTCAGAGATCTATGAACTGGATGCTAAGACGGGCCAAAATACTCACTCGGAGGCA
CTCACTAAAGGACACTTTCAAGGCGAACTGTGGGGATTGGATATTCACCCCACAAAGCAGCAGTGTTGTACCATTGGAGATGACCAAACGCTTCGCATTT
GGGACTTAGCAATGCAGCATGAGTTGGGATTCTTAGAGTTACCGATTCCAGGACGAGCTTGCGCTTACTCTAGCGATGGCAAATTAATCGCAGTCGGTCT
TGGCACGGAGGAATCTGGCAAGACTGGAAATCCGTCTCGGGCAAAGACCTCATCAGCTAGTTCTAAACGACGGCAGCCTAACGGTGGCTTCGTGGTGTAC
AGTGCGATGGATTTAACCTGTGCAAAGGAGCCTTGTTATGAAGCAAAACGTTGGGTGAGCGATATAAAGTTCTCCCCAGACAACAGAACGCTAGCAGTCG
CAAGCCACGATTCCAAAATCTATCTGTACAATGTTCTGAAAGGTTTCTCAAGAACTCACGTTTTCAGTAAACACTCGAGCTATATCACACATTTGGACTT
CTCACTGGACGGGAACTACTTACAGAGCACCTCAGGCGGATACGAGCTTTTATTCACCGAAGTTAAGTCTGGCAAACACGTCACAAGTGCCACAACATTT
CGGGACGAATTATGGCACACTATGACCTGCACGCTGGGCTGGTCAGTGCAGGGAATCTGGGAAGCAGAAAGCGACGGCACAGACGTAAATGCCGTTGATC
GATCTAACAACGGAAAGCTGTTGGCAACAGGCGACGATTTCGGAAAGGTGAAGGTCTTCCAGTATCCTTGTGCCTCGGAAAAAGCCTCATTCCTCGAGCT
GCGTGGGCATGCTTCTCACGTCACGAACGTTAGGTGGTCGCCTGGTGACAACTACATAGTGTCTGTAGGTGGAAATGACAGGTGCCTATTTGTCTGGAAA
CATGACCAGCAGCCCACAATGGAAGACGCCAATCACAAGCGCAACACTACCAAAAGTGAAACTACCAGTTTCGGAATCGACTTACTCAGTACGAGAGCTG
AAGACCCTTTGGAGGTCGTGGCTACGAGCGATGATATTGGAGATGAATTTATGGCGGTACGACCATGGCTCGGGGCCGTTGTGGCGCCTTCAAAGGCTGC
TTCGCTGAAAGTGGACAACACGTCTCCGAACTCAAGGTTGGAATTGGAGCGAGTTCACGGCTATCAAGCTCAAACTGCTTCAAACAATGCTCGATATGAT
TCCAACGGCAAGGTTGTATATCATACTGCCGCGCTTGGTGTTGTGTTCGACAAAGCTGCTCAGCGTCAGGCTTTCTTTAAGAGTCACGACGATGACGTCG
TCGCATTGTGTCCTCATCCGAATGGTACAACCTTTGCTACGTCACAAATGGGAAAGAAGCCCAAGATATATGTCTGGGACTCAGTGAGCGGAGCAGCTGT
AGCTCCCTGTCTGGAAGGATTTCATCAGCGTTTTGTAAATGTTATTTGCTTTTCAAGCGACGGCACAAAACTCGGAAGTGTTGGTGGCGATGATGATCAT
TCCATTGCAATTTACGCTTGGCAGAGTGGTGTATTGGTATCACAATCTCGTGGAGAACGCAACAATGTGCGCGGTATGTGCTTCCATGCTGCCACGATGG
AGTGGGTGACATGTGGTGACAAACATATTCGATTCTGGACGGAGCAAGGGAAAAACTTAACTTCGAAGAAGGCAATTTTTGGGACGAAGGCGTATCAAAA
TGGAAAGGTTCCGTCCGTCTTTGACTGTGTTGTATCGTTTGGGCAAATGGTAATTGCGGGTGGGTCGAGTGGACATCTACTTGTATTTCAGAGCTCAGTT
GATTTGACAAAGGCAGTACCGGCACATGACAGCGCTGTATTGGCACTGTATTCAACAGAGAGGGAATTAATTAGTGGTGGAAAGGACTCCAAGGTCATCG
TTTGGGATGCCCAGCTAAATAAAGTGGCTACATTCGATATGAAGGAGTACACACTTCAGGGGGCCAAACTTTTGAACTCGGAGATTCGAAGTGTTTCCTC
TAACCGAGTTTCTCCTAGAGTTTTCTTAGTTGGAACTGGCGGGAGCGATCTACTTGAGCTCGATGCTGGCCGCGCTCAACCAACTTTGTCTACAATCACA
CGCGGACATTTCAAAATGGAGGTCTGGGGTCTTGCGTGCCACCCAACCAAACCTGAATACTGCACTGTCGGCGATGACCAAACTATTCGAGTGTGGTGCC
TCGCTAAGAAAATTCAGCTAAGGGTGCAGAGGCTTGAGTGCGTAGCTCGAGCCTGTGCATTAACGGGCTCAGCCGACATTGTCGCGATAGGATTCGGTGG
GCGCAATGCGGTGACTGGTCTATCAAAAGCTGCCCAAGCAAAAACAGGAGGTATTGTTTTACTGAGCTACAGTGACTTGACGAAAAAGGTGTTTGAAGAT
CGCCCTTCCAAGCAAGCTATCAGCGAGATGAAGTTCTCGCCGAGTGGTTCCGTTCTTGCCGTTGGGTCGCATGATCATAAGATCTACCTGTATCGCCTTG
ATCGGAATACCACCAAAATCACCAAAGCATCAGCTTTCGACAAGCATCAAAGCTACATAACTCACCTTGACTTCTCAGCGGATGGTCAAGTGTTACAAAG
TAATTGCGGCGCCTACGAACTTCTTTTCAGTAATGCTACCACAGGTAAGCATATCACATCTGCGAGCAGCACGAAGGATACTCAGTGGCATTCGTGGACA
TGCGTGCTTGGGTGGCCCGTGCAAGGCATTTGGCCGCCGTGTTCCGATGGCACTGATGTGAACGCAGTCGCTCGCAATTCACGCGAAGACCTACTGGTAA
CCTCGGATGATTTTGGCCTGGTCAAGCTTTATCGGTATCCATGCGTCGCTAAGAATGCGAGCTCCATAGATCATCGCGGGCACTCGTCCCATGTGACCAA
CGTCCGGTGGGCTCTTGACGATAGCTATGTGATCAGCATTGGCGGAAATGATCGCTCCGTGATGGAGTGGAGGGTCTTAGGGCAAAATGAACGGGTTCCA
GCGGCGGGATCTGAAAAGATATTGAGCTTTGTTGAGGCAGAGGAAGTCACGGATTCGTCTGCTGAATCGGAAGAGGAATCGTTTGATGAACCTGCGGGGG
ACGAGTTTATGGCAGTAAAACCTTGGGTTGGAGCGATTGTTGCACCCACGAACGCTGCCACGCCTAACTCTCGTGAGCCCGAATTGAATGTTGAGCTTGA
ATGGGTGTACGGTTATCAATCGGAACTATCACAGCAAAACCTAGCGTACAATGCGCAAGATGAAATTGTCTACCACACTGCTGCGGTGGGAATCATCTAC
GACTCTGCAAACCATCTCCAAAAACACCACGTTGGGCATAACGACGACATTATCAGTTTCGCGCTTTGTGACGCCAAACGCAACCTCATAGCAACAGGAG
AGAGGGGAAAGAAGCCTTCACTAAGGGTATGGGATGCCCACACAGGTGAATTACGATGCGAGCTGAAGGATGCTCATACTCGCGGCATTTTGTCGCTTGC
GTTCAGCAATGACTCGACAAGGCTTGTCAGCGTAGGGGCAGATGATGACCACTCACTGGCAGTTTGGAGTGATGCCAGTAATGGATCATGGACTTTAGCA
AAACTTCTGGCAACGGGTAAAGGGGATAAAGGCCTGAACCGCTTTGCCTCGTTTGGTTCCAATCTAGATACGATTATCACTGGCGGCGTGAAGCACGTGC
TGTTTTGGTCTGTCCAAGGAAAAACCATTGTCTCCAAGAAGGGCGTAGTTGGCAAGAAAGGGACTTTGCAAACGTTTCCAATGGGCTGCAACTTCGGAGG
AGACTTTGTAACAGGGACGGCAGGTGGTGAGTTGTATGTCTGGAGAGGCAATGATCTCTCAAAGACGGTGAAAGCACATGAAGGGGAAGTCCGAGCCGTG
GCCAGTACGAATTCAATTGATAACCCGGCTGGAAATTCATCAGTTCTGCTATCAGGCGGAAAAGATGGTCGAATTATCATGTGGAACCCTGCGTACCAGT
CGCTAAAGTGTTTTGATCTGGACGCAATGCACGCCGGGAGCTTTGGCAGGATCATCAATAGCGTGTTTTTAAGCTCTACTGGCACGAAACTTCTCGTCGG
TACTTGCTCCAGTGACATCATCGAGATAGATGTAGTCAGTGGGAGTGTTCTCAATGGAGGCCAGCCGCTATTCTCCGGTCACTTTGCTATGGAGCTCTGG
GGGCTTGCCGTGCATCCCTCTCAGCGAGAATTTATCACCGTTGGTGACGACCGAACGCTGCGGGTGTGGGATATGGAGGCTAAGCGGTTAATTCAGGCAC
GCGCACTACCTGCAAAAGCTCGTGCCTGTGCATACTCGCCTGATTCCGAGCTGCTAGCAGTTGGCTTTGGTGGCGACAATGGTGTACGCCAGAAGAGAGC
AGCAGCAGCCAAACAAGGGCAAACACAATCGAGAGAAGGAGGGTTTGCTGTGTTTCGATCACGTGACCTTGATACAGATAAAGTGGTGGTTGAAGACAAG
CCAGCTAAGGAATGGATCAGTGATATCAAGTTTTCGCCCTGTGGACGTATTTTGGCGCTGGGTTCTCATGACAACGCGCTTTATCTCTACTCTGTGGGCT
CCGGGGCAACAGAGTTCAAGAAACGCAAGCCATTCAGCAAGCACAACAGCTACATTACACACTTTGATTTTTCAGACGACAGCAGCTACATACAGTCGAA
TTGCGGCGCATACGAATATTTGTTTTGCGATGCAGCATCGAGTAGCCAAGTGAGTCGAGCTTCATCTCTACGTGATGTGAAGTGGGCAACTTGGACATGC
ACCTTAGGCTGGCCTGTTCAAGGTATCTGGCCTGAATGTGCCGACGGCACTGACATCAACGCTGTTTGTGCGTCTTCATCGCGTACAATTCTCGCGTCGG
GGGATGACTCCGGCAACGTGAAGTTTTTCCGGTATCCTTGCATCCCAAAAGGGGTACGTTGCCTACTATTACGAAGACTTTGCGTGCACCTAACACCTTG
TTTTGTTATTGCATCTGCAGTCAAAGTTCATTGCCTGCCGCGGCCACTCTTCGCACGTCGCTAATGTGCGCTTCAGCTTTGACGACAAGTACGTGATCTC
AGTCGGCGGAAACGACAGATCCATTTTCCAGTGGAAGCTGGCCTAGCC