Description :
From Genome Similarity Track
Location :
Scaffold_66:53254- 55950
Transcript NameFunction/comments
Pytap_DAOMBR444snap-pag1_scaffold_66-abinit-gene-0.112GTPase

Sequence
2696 bases(100 bases per row)
ACCTAGAGGCAACATGCTGCGACTCTCCTGCCTCGCGCGCGCCGTGTCGACGACGCCGCTGCGCCTGGGCGTTGGCCGTAAGGCCAGTGGACTGCTACGC
CAAGCTGGCGCCGGCTTTTCAACGCACAAGTGTGACGACGGCAATAATAACGACGACGACGATGATGATGGCAATTACATGgAaGAGGACTGGAGTGACG
ACGAAGACTTCGACATGGACGACGaCGGCTTTGATATTGgCAGTGAGTGGGGTGAGAACCTGGctGCTGGCGGTATCCCTGGTCAGGGCAACCGAAAAGT
GGAGGAGCACGTGAAGCAGAAGGTGAGCGTGCGCCGTGCCAAGCACTCGAAGCGCCGCTTCGTCGACCGCATCCGTATCAAGGCAACGGGTGGTCATGGT
GGCAATGGCTGCAGCAGCTTCTTCAGCGAGTCGGCGATGCGCAAGCGTCCAAACGGCGGGCACGGAGGCGCTGGCGGCAACGTCATCATCCAGGCTGATC
ACCGCATTCAGAACCTGGCGAATGCGACGCACCACTTCCGTGGAGGCGCCGGTCTCAATGGCATGCGTACGTACACTCGTCTGTAACGTATGCTTCTGAC
TCGGTGTGACCGCTCATCGCACTGTCGTTGTTGTTGTCTTCTACAGCAAACGACGCCGCTGGGAAGCGCGGCAAGGACTGCATCGTCAAAGTTCCATGCG
GGACGATCGTGAAGCGCGTGgACCGTGTAAGGACATGGCTGGCATGGCGACACTTCTGTAGGCTTCATGCATCTAACTGTGAGTCTGTGGCGAGGTAGTA
CGAGCGTGATCTGGACGAGGATGGCCTCGACTTTGAGATCGTTGATCGCATGACGCCTATTTGCGACCtcGACACCGATGGAGCGACGTTCCTGGCTGCT
ACTGGCGGTAAGCCTGGTCTCGGCAACCGCATTCTCGCTGGTAAAACCACGAACTATGGACGTCTCCGCAAGCACATGCCTGAAGGCAAGAACGTTGGCT
CTCCTGGTACATCGCAATACTATGAGCTGGAGCTCAAGACCATCGCCGACGTCGGTCTAGTGGGCTATCCTAATGCTGGCAAGTCAACTCTTCTCAGCCG
TCTCAGTCGCGCTACGCCCGAGATTGCTCCGTACCCGTTCACCACGCTCCACCCGTTTGTCGGTATCGTCGAGTTCCCTGACACATATCGCCTGAGTGTT
GCCGATATTCCTGGTCTCATCGAGGGAGCTCACCGCAACGTTGGCCTCGGCCACGACTTCCTCAGACACATTGAGCGAACCAAGGTACACCcATGAATGG
TGGCTCCGTCACATATTGCTGGCTGATCATTTTGGGCATTGTAGATTCTGTTATACGTCCTTGACACTCCTGGTACAGAGGGCCGTGACCCAcTCAAGGA
CTTGGAGCACTTGCAGCGCGAGCTTGAGCTCTACGCTCCTAACATCACGACGCGTCCATCTCTCATCGTCGCCAACAAGATGGACGAGCGTGGAGCGGAA
AAGAACTTGCTTCGTCTCCGTCAAGCTACCGACATGGCCGTGCTTCCCATCAGCGCGAAGCACAAGGTCGATATTGACAGCGTCGCTAGAACACTTCGTT
GGATGATGGAGAACTACTCGAAGCTGACCAAGGACTAGTAAGCTAGGAGGGGgTAACGAAaTACTaGTAAACCCTGTTGACATGCTTCTCGTGGgTGCTG
TAACATAAAAATAGCGGGTAAGAGAACTGGTGATCAAGCTCTCAAGCTACAtGTCGTAGTTGCTTCTGTACGCACAATGAATCGATACGAGATACTCGAG
CGACTTGGCGATGGCTCGTTCGGAGAAGTAAGCAAAGCCCGCAGTTTGAAAACCAATGAGATCGTCGCGATCAAGAAGATGAAAGCTCTATATCCAACGT
GGGAGGAGTGCCTTCAGCTCAAAGAGCTCAAGTCACTTCGCGTTCTGCGTCACGAAAACGTCATTCAGCTGAAAGAAGTAATACGAGACAAAGAAGAGCT
CTACTTCGTGTTCGAGTACATGCAGAGCTCGTTGCATAAAGTAATGCGTCAATtACGCTCGTCAAGCACACCTTCGTCGTGTCCAGACGCAAATGAAATG
CCCACGCGATGGCTGACGGAGGCTCAGATTAAATCAATCATGTATCAGCTCTTCTCAGGACTCGCATACATGCACAAACACGGCTTCTTCCACAGAGACA
TCAAGCCAGAGAACCTGTTGTGCCATGATGAGACACTCAAGATCGCTGATCTAGGCCAAGCGCGTGAGATTCGATCTCGGCCTCCGTATACAGACTACGT
CTCAACGCGCTGGTACAGAAGCCCGGAGCTTCTGCTTCGTTTCACGACATACAACAGCCCAATCGATCTTTGGGCCTGTGGCTGTATAATGGCCGAGCTC
TACCTTCAAGCACCTATCTTCTCCGGGTCGTCTGAGGCAGACCAACTTTGTCGTATCTCGAAGATACTCGGTTCTCCTACCAAGGAGAACTGGCCAGAGG
GAGTGTCTACTCTGGCTCAGATGCAATTCAAGTTCCCAAAGTGCTCGCCTTTGCCGTGGAAAAGTGTTCTCCCTGGCTACACGACCAGTGCCGCGAGGTC
TCTCATCAATGAGTTGCTCCAGTATGACCCGAGCAAGCGCCTGACGGcgACACAGGCTCTCCAGCACCGCTTCTTCGATCAGCAAGTTCCTCGACC