Description :
From Genome Similarity Track
Location :
Scaffold_1803:5325- 6642
Transcript NameFunction/comments
Phyta_totarag13680hypothetical protein

Sequence
1317 bases(100 bases per row)
GAAGTTGGCCAGTGACAGAGGCGACTCAGTGACCAGATCAGGAGCGGCATGCGCGGAACCAAGATCAATGGCGGGAGCTGGGTCGAGGTCGATCGTGGAC
GCCGACGTTACCGGAGATACATTCGCCGCTGGCGGAGACGCAGtagcagacgcagcagacgaaGATCGAGGCGCGGCATTCGCAGCGGGTGCAGCACCAG
CCGTAGGCGCGGTTGCAGCAGTCGGCGATATAAACGTAGCGGCTGACGGCGTTGCCGTGCCGAGAGACGCGCGATCTCGGCGAGAATGCCGAGCGCCGGG
GGCTGCAGGCGACATAGCACGAGGTGGCGTGGACGTGGTTGCGAGCTggcaagttggagaatgaCGACCAGAGTACAGCGAGTGGATACCGTTGCGCGGC
TGTCACTCGTGCAGGGGACggctgtggtgaagtggacgcagcaatttcctggtcgatctatATCCATCACTCGAGATCGACCAAGTACGAAATTGTACAA
GCGGGACACCCACAAAGTATGACGACtccaagattgatggctacacaagATTGATAGCTACATTCTCAGCACTTCTGATGAGAATCAGACTGATCAGGCG
TTATCGAGCTTGACGGGGATTGCGCCAATATGAAGAACGAAGCCTCGATCCAAGTTCCACTGATGGCGAAACAGTCAAGGAAAGCCAGTGAAGCCAAGGG
AATAAAGGGAGGTCTAGATAATTGTATGGGAACCATAGGATAGTTTTTGGGACATGCTAACATATACttcagagtcaaatttgccttctacagcACAACC
ACGGACTACCTGGAATTATCTGCTTGGNTGCCTACGTACAACTTGACGTCTTCCATAGCTGGTGGTTCGATCGAGGTCGTCTCTCAGGGTCGTAAGGGGC
CTCCTGGGGTTCCGTTCGAACCCCTGTGGCTCTTCTCACCGGAGACGTGGCTGTACCGAATATGCGCGCGCTGGCTGCTCCCACCGCGGATGCGCCGCCG
TTCATTTATCTGTCGCTAGCCACTGAGGACATCCAGGCGACCGCCCCGGGAAATCCTGGGGATCCAGGTCCGCGACGTAGAGGGTATTGCCCACTTTGCT
GTTCGCGTACCAGAATTGACGGTTCCACAAGTGAGCATGATGGCTCGCTTGGTTCCACCAGGAGAGACCCCCCCCCATGGGACGGGACTTCTGCGTGTGA
AGATTCCGGAGGGAAACTTGCGGAGGTGGTCTCTCTAGAATCTCCTCCGTCAGGGACTGGTGCTTCCACGGGTGCTGCATCCCCTACCCCCCAGATCGTC
CTACCCCCCGGGAACCC