Description :
From Genome Similarity Track
Location :
Scaffold_6:532312- 537068
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G002888Similar to RGAG4: Retrotransposon gag domain-containing protein 4 (Homo sapiens)

Sequence
4756 bases(100 bases per row)
GTGGATGCCGTAGTTCACATAAAATGGAGAATGACCTGTCGAGACATGCGTGGAGTTGTTCAACGCAAACTCAGCGAGAGGGAGAAACTCACTCCACTCT
CCGAAAGACGTCGCATAGCTGCGCAACACATCTTCCAGGACACGATTCACTCGTTCAGTTTGACCATCCGTCTCCGGGTGTGCTGCTGTTGACATGGACA
ACTTCGTATCCAAAAGGCCAAACAGAGCACGCCAAAACCTGGACGTAAAACGAGTGTCACGGTCAGACACGATCTCGACTGGTAGGCCATGTAGACGGAA
AACAACGTCTACAAAGACCTTGGCCGTCATTTCGGCTGAGATCTTGTCCGAAACCGGTGCAAGATGGACCATCTTACTGAATCGGTCCACAAACACAAGG
ATGCCATTGCGTCCGTGTTTGTCACGAGGAAGTCCGAATATGAAATCCATACTCACAGACTTCCAACTGTCCGATGGGACAGCCAATGAACGAAGTGGGG
CTTGCGTGGAGCCAGATGGCTTCACACGCTGGCAGATCTCGCAAGTTCTCACATACTTGCGAACCCACTTGTACATGTGTGGCCAGTAATAATCCCGGGA
AAGACTGAGAAACGTTTTCTCACGTCCGAGATGGCCACCCGAAGGACTGTCATGATACTCATACAAGAGTCGATGACGTAAACCTTCATCGTTGGGAACA
ACAACTCGTGCTGTATCCTCAACTTCCACCGCATAATACAACAACCCATTGTGTACTCGGAAGCGGTGAACACGCGATCTTGTTCTAGCAGGCAAGCTCT
GCAGTGCCTTGTCAGAAGGGTCTTTGAAGTACTTCAACAAGTCCTGACAAGTTTCGTCAGACTTGTACCCTTCGACAATCTCTTCTCGCACTGTCGTCGT
AGCTTGAACTGCGATCGCTTGAACATCTTCGCAAAGTCGACATTCTTCGTCCAGATTTTCACTCTTGGACTTTGGATCGTAATCCGGACGTCTTGATAAT
GCGTCGGCTAAGATGTTCGTTTTGCCTGGCTTGTAGTGTACAACAAAGTTGTACTCTGCAAAGAAGGAAAACCATCTCGCCATTCTTTGCGACAAGTGAG
GAGTCTTTACCGCTGTCCGCAGTGATGCGTGATCAGTGTAAATAGCAAAGCGCTCCTCGCCAAGCAGATAGACACGGAACTTGACAAGAGCATACTTCAT
CGCCAGAAGTTCCTTGTCATGAACTGGGTAGTTCCGTTCTGCGGGTCGGAGTTGTCGTGACTGATACGAAACAACTCGCTCTCGACCCTCATCATCGTGT
TGCATCAATGCACAACCGATGGCATAGTCGCTCGCATCACAGACGACATGGAACGGCTTGTCGTGGTCCGGTAAAGCCAACACAGGAGCTTCACGAAGAC
TCCTCTTGACTTCTTCGAACGCCGTTTGATGGTCTTTCGACCACTTCCACTCAACGTCTTTCTTCAAGAGCTGTGTGAGGGGTTGCACTAACGCTGCATA
ATTGCGCGTGTACTTGTGCAAATAGTTGGCCAGACCCAACCATTGGCGTAGCTGTTTGACGTTCTTTGGCTCAGGCCAATCGTCAATAGCTTTGACCTTC
TCCGGATCAACTCGAACACCGTTCTTGCCCACAAAACAACCGAGAACAGGGATCTCGGGAGCGAAGAACATACACTTCTTCAAGTTTGCGTACAGTTTGT
TTTCACGCATGACCTGGAAAACTTGACGAAGATGATCAAGATGAACATCAACATCAGATCTCCCATTCGTGGCCTTACTATGAACGAAGATATCGTCAAA
GTAACTCGGTGCAAATGTTCGTAAAGGACGAAGAACGTTCGTGACCATTCGATTGAAGGTCGCAGGTGCATTCTTCAGTCCCTGTGGCATCACTAACCAT
TCCCACAGCATACCACTAGGGGTACTCACTGCAGTTAGTGGGACATCATCTTTGCGCATTCGAATCTGATAGAATCCATCTTTCAGATCGATAGCACTAA
AGACGGTGCTGCCAACCATTCCATCAAGGATCATGTCCTTGCGTGGAACCGGAGTTTGAGCAGGAATAGTCGCGTCGTTCAGCTTGTTGAAAGCGTGAAC
AATGCGCCATCCGCCAGTTGCCTTCTTCACACAAAAAGTGGGGCTACAATGTGGAGACTTGCTCTCGCGCACATGCCCAGCCTTCGCGCGTTGCGCAAAG
AACTCATCAATTGCCTCGACTTGTTCCTTTGGCAACGGCCACTGTCTTGTGATACAGTACTTCGTGCCAGGAAGTACGTCAATCTCGTGACGAATGCCTC
TATCAAATGGCAGTTCGTCCGGCACCTTGTCTGGGAAAATGTCTTCAAATTCCCTGGCAAGTGCATACACGGGGTTCATCTTGAGAGCATCCCACGACTG
CTCCTCGAACCTTTCCTTCCGTGTCTTTTCATCGAGCACTTCGGCTTCCGTTGCTGATACCGTGCCGATGTCCTCTGCATCGTCAACATCGACGATCATG
CAGATCTGCGAGATTTCGCCTCTCGTTAGGCTACGCTTCAGCGTCTTCTTGCTCATCCATGGCAAGGAAATCAATTCTTCGACTGAACTTGGGGGATTTT
CAATCTTCATGTGATGGATTACATCGACGTCACCATCTTCGTTCGAAACCAGAACGTTCACAAACTCGCTTGAAATGTCTTGTGCTTGGACACTTCCTTC
GTCATCTTGACTTGTACCTTGATCAGGGGCACTCAAAATTCTTGGCGGAACACTCTTCTTGCTGGTCTTCTTCTTCTTGTCTTGGGATGGGTCTCTGCCT
CTTTTCCCGTCGTTCTTCACACTACCATCGCACGCAACTTTGTCGTCGATGGCAAAGAGACAGTCTTTTTATGGCGCCTGACTGCTCCACCTCCGTTCGT
CTTCTTCAAAATGGGTGCCGCTTGTGAGCATGGGGGGCCATCGCACACCGCAATATCACAAGGGCCATCTGAGACTTCTTCCACAGATGTGTAAACCCAT
ACCACTTCATCCGTTGTCATGCAGCTCAAGTCGGCGATGCACGACTTGTCAACGGAGATCTTCATCTTCATCCAGTCAATGCTAGGTTGGTAACGCTTCA
ACCATGGCATGCCCAGGATGATATCAAACTTGTCATCGAGGTCGAGTAAAATGAACTCGTCTTCACCTCGGAAATCTTCATACTTCATTGCCAAGCGAAC
AACTCGCTTTGGCATCTTCACAGTTGACCCGTTGGCCAACCGAACAATCATCATCTTCTCTTCATTCGCAACAGGCACAGAGATGTTGTGCCTGGTGATC
ACTTCATTTCGAACAAAGTTGTTCGACGCACCAGTGTCAACTAAAGCTCGTAGAGGCGTTGCAATACCGTCTACATGAACTTTGAGAACGATCAAACTTG
ACGTTTGACTGACACTGTTCTCACTCGTGGAAACTGCATGTGCATCATGCACATTGGGGCCAGAGTCCTGTGTTTCCACAACATCCACAGTCCTCTTCTC
GAGCCCAGTAGGAGGCCCCGCCCCTACTGGTCGTTCCCGTTTTTTGACCTTTGGGAACGATCGAACCGACGACCATTATTACGGTCGTAGTTGTTCGAGC
GCGAGCCCTGTGCCGTTTGCCGATCAGGCAAAGACACTTTGCAGTTCCGAGCGAAGTGACCCGGCTTCCCACAACGGAAACACTTTCCATCGTTGCGAGG
ACGTTCATTTCCAGGAGTGGAAATGTACGAGATGTCCATCGGCTCTGGGCCATCATGAACAACGTTTGGTTGCCTTGGTGGTCTTGACGGAAAACCTTGG
AACTTGGCTTGTTTGATGCTAAACTCTTCTTGCATCGCACGGCTGATGGCTTCTTCAAGGGTCTTTGGGTACTCACGGAACAAACTGGTTCCGAATCGGA
CCATCGTTCAGACCTGTCATGAACGTCACGACTTGCGTTGGGATGTCAATCGGCTCGTCCACGATGCTCGATACCAAGTAGCGAGCTCGTTGTGCGTACG
AGTGTAGGTCGTATTTACCCTGACGAAGCTTTAAAAACTCTGCGCGAGCCCGAAATTCGCTCTGCGGAGGTTCAAAAGCCTTCTTCAGCTCTCGCTTGAA
GTCGTCCAGGTCGTAGAAGCAATGTGGCTCCGCCAATCGCTTCCCATACGCCCAACTTTTCGCTCGACCCGCAAGTTTTGACATTGCAAACAACACTTGC
TGTATTGGGTCCCGTAGTTGTCTTGCAGTGATCGCTGCATCCAACTCAACGAACCATCTCGCTAGAGGCTCGTTCTCTCCGCCACGGTACGGAGATACAT
CGAGCTTCAGAGGTGCTACTCTCATCGTCGTGACAGGAGTTGCAGACTGTCGATGAGAGTTCATGATCTCGTGATGCATGAAGCTCGTAGCCGCGTTCCT
CTGCTCATCCGGTGACGCTGATTTCAGCAAGCTGATCACAGCCGCCTCACCGATGACCGCTCGCATACGCTCGAGGGCTGCCCACTCGTGGCTCGACAAA
TGAGGAAAATGCTCATTCGTCAGCTCCACGGTTTCTCCAGGCATCGAGCCCATCGGCGTCTCAATCCCTTCCATTGTTTCTCACAATCGGACAGGGGTCT
TGGAATGTCTGCGCACGCTACACAAGCGGCCTATGCAGACTCTTGACGTGGTCGTTGAAAGGACTACCAAGTGCTACCAGGTGTAAGAGGCTATCCGAGA
CAGCCTCAAACACAGCACGCACGCTTGCGCTTGAGAGGAAGACTTGGGAGGAACTT