Description :
From Genome Similarity Track
Location :
Scaffold_86:53227- 54976
Transcript NameFunction/comments
g7096.t1XP_008909502.1 hypothetical protein PPTG_14740 [Phytophthora parasitica INRA-310

Sequence
1749 bases(100 bases per row)
CGTGCGTACCAGCTGCTAACGGTGGACAACTTCGATGCCGAGCCTCGCTCGGAAGAGGGACGTCGCCGCTTGCGTTTCTTTGCCAACTCGCTGTTCATGG
ACATGCCGGAAGCGAAGCCTATCCGTAAAATCCGTTCGCTGACGGTTTCGACACCATACTACAACGAAATTGTTATGTACTCGATCAAGGATTTGACGGC
ACAGAATGACGACTGCATCAAGCTGTTGTACTATCTGCAAACCATCTATCCATTCGAGTGGGAAAACTTGCTGGAGCGCATTCCGGCCAAGGACATGAAC
GAAGCGCTTAAGAAGAACCCGGAGGAGGTTCAGCTGTGGGCCAGCTACCGTGGTCAGACTCTGGCGCGTACTGCACGCGGTATGATGTACAACGAAGAAG
CTATTCGCTTCCTTCACTGGCTGGAAATTGGCGAAAACGAGCCGATGCACCAAGTGACGTGCTCGTGCAACAAGTGTTGCAAGTTGAACGAAATGGTTGC
CCTGAAGTTTAATTACGTTTGCACGTGCCAGATCTACGGTAAGCAGAAGGATGAGCAGAAGCAGCAAGCTCAGGATATCGATTTTTTGCTGCGCAAGCAC
CCGAACCTTCGTGTTGCTTATGTGGACGGACCAAAGAAGGTGAAAGATGGCCCGCCAAAGTTCTTTTCGGTGTTAATCCGGGCTCTGGACGATAAAATTG
TTGAAATTTACCGAGTGGAGCTGCCGGGTAATCCGATCCTTGGTGAAGGTAAGCCTGAGAACCAGAATCACGCTATTATCTTCTCGCGCGGTGAGCTACT
GCAGTGTATCGATATGAATCAAGACGGATACCTTGAGGAGGCTCTCAAGATGCCGAACCTGCTGTCGACAATGGATAGTGGCACGGAGAAACGCCCTTTG
ACAATTATTGGTTTCCGTGAGCACGTGTTCACGGGCGGTGTGTCGAACCTGGCCAGCTTCATGTCGATCCAAGAACTGTCGTTCGTATCGCTTGGCCAGC
GTATGCTTGCCCTTTTCCATGTGCGTCAGCACTACGGTCACCCCGATATCTTCGACAAGCTCTTTGCCATGAGTTGTGGTGGTACTGCCAAGGCTTCCAA
GGGTGTGAACCTTTCGGAAGATATTTTTGCTGGTTTTAACTCTACTCTACGCGGTGGCCGTACTTCTCACGAGGAGTTCATCCAGGTCGGCAAGGGTCGC
GATGTTGGTATGCAGCAGTTGGCTCTGTTCGAGGCGAAGCTGTCGTCGGGTGCTGGTGAAGCAGTTATTTCCCGTGATGCGATGCGTATGGCATCTCGTC
TGGATTTCTTCCGTCTTAACTCGTGGTTCTACGGTAACTTGGGTTGGTACTTCACGCAGACGATGACGGTGGTGGGTGTGTACTTCTTCATCTACGGCAA
GGTGTACATGGCTCTGAGTGGCATGGACAGCTACTTCCTTGAGAAGGGTGGACTGGGTATTGCCGGTACGCTTAATACGTCATGGGCGTTCCAGTTCGGT
TTCTTGTTGGTGGTGCCTGTTATTGCCGTTGTTGGTGTGGAGCAGGGTTTCCGTCATGGTTTCACCTATTTGCTGTGGAACATCATGACTCTTGGTCCGA
TCTTCTTCACGTTCCAGATGGGTACGCGTATGCACTACTTCGACCGCACGCTGATTCACGGTGGTGCTAAGTACCGTGCGACGGGTCGTGGTTTCACGAT
CAAACACGAGAAGTTTGCGGAGCTCTACCGCTTCTACGCATTCAGCCAC