Description :
From Genome Similarity Track
Location :
Scaffold_61:53224- 54529
Sequence
1305 bases(100 bases per row)
ATACTGAATATGACTAGAGCATACTTTGTTGCAAGTAACACTTTGTCATGAACTGGATAGTTCTTCGCTGCAGCTGTGAGCTGGCGAGATTCAAACGCAA
TCCCGCGTTCACGCCCTTCGGCGTCTGCTTGTAGTAAAGCACAACCGATTCCAAAACCGGAGGCGTCACAGACGACGCTAAACGGACGATCCGGGTCCGG
TAGCGACATGATCATAGCCTGGAGGAGGCTCTCCTTCACAGCCTCAAAGGATCCGTCGCACTTGACGTTCCAGCACCATGGTGTGTCCTTCTTAAGGGGA
TCGGATAATGGCCAGCCATCTCCGCGTAGCTCGCGCTGTACTTATGCAAGTAATTGGCTAAGCCTAGCCGCTTGCGTAAGTCTATTTGGCTCTTGGGAAC
CGGTCAGTCCACGATGGCCTTGACTTTGGCAGGATCGGCCCGTAAGCCACGCTTTCCCAATGAAGCCCCGAGGAAAGGTATTTCCTCTGCGCCAAAGACG
CACTTGTCCAAGTTGGCATACAACTTATTAGTGCGCATACACTCGAGCACCGCTCGCAAGTGACCAAAGTGGTTCTCCACGTCTGACTTTCCGTGCTCAG
CATGACTGTGGACGAATACATCGTCAAAGTACGTCTGAGCGTACGCCCGGTGGGGCCTAAACAACTGCGTCCCAAGACGATTGAACGTTGGTGGTGCATT
CGATAGCAATTGGTAGTGACCATCGACTAAATCGAGTGCGCTGTACAGCGTACAACCTACCATGTTGCTCTGCAGATCATCCTTGCGAGGAATCGGCGTT
TGCGCCGGGACGGCAGCCGCATTCAGCTTGTTAAAAGCTGAACAATGCGCCACTTGCCGTCCGGCTTTCTGCCACAGAACGTGGGTGTCGAGTGCGGAGA
CTTACTCTCACGCACCATCCATGCCTCGTGCTTCACACGGAAGAATGCGTCAACGACGTCACACTGGTCTCTCGGTAAAGGCCATTGCCTTGTCACGCAG
TATTTGGTTCCAGGAGCCAGGTCAATCGCATGACACACGCCTCGATCCGGCGGCAGACCCATTGGTGGTCCTTTCGAGACAACGTCTCCATACTCATGTA
CCACAGGGTAAAAGGGATCCGAAAAATCTTTTAGGATCGTCGATCCACTTCTTGCGCTCAGCGCCTTATTGGTTTCATCTAGAATCCCCGGTCCCATGAC
GGATAAGGAGTTCAACTCTTTCCTCAAGTCCCAGCAGGACCGACTCGACTAGCTTGCCTGCCTTCAAGGCTTTGCTAAACTCGTCAATAAACATCTCCTC
CAACT