Description :
From Genome Similarity Track
Location :
Scaffold_767:5322- 9373
Sequence
4051 bases(100 bases per row)
GCCACTCGTGCGCTTGAATGTCCAAACGCTCGGGTGGCCCAGCGTTAACATGGGAGCCGTATTCTTCGCTGTCGATCATGTTCTTGGTCTTAATCAGCGG
GATTTGGACTTCGTGCGGTAATTGCGCCGCGCCGTGGAACAGGTCCAACCGGATCCCAGCTGGGATCATAAAGTCGGTCCCAAGTACTACGTCGACGCCT
GCACTATGCGCCATTACCCACATCTCGAACTCGTACACCATCTCCCATCCAAGCGTAATCTTGACGCACGCTCGTCGCGTCGTAGACACCTTGCCTTCGT
TGATTCCTTGAATGTCAATGCGGCGTCCGTGATCAGGTACATCTCGGAGTCGCAACTTCTTGGCAAAGGCGTCAGTGATCACACTAACGTTTGCTCCTGT
GTCGAGGAGGATCCTCGTTCGCTGGTCATTCACAGCGCCTTGCACCAGAGCTCTCATTCTGATCCGTCGGTCGAATTTCTTGGCCGGCCACCACCCCTGT
CTCTTGCCAGGGTTCAACTTCATCATCTTGGAGTGACCCTTGGGCTCGTCTCGCGCTGCACTCGAAACCAAGCCGAACGAACCCTCGCTGGTACCCTCAT
CAGCATCAGCACACTCCACTCTCTCTCCAACACCTCCACCGAGGATTCTACTCCTCTCCTTTTCATTTTTCGTCGCGCTCACACTTCTTACGTAATTATC
AGACCATTCACTCTGCCCCATGAAAGCAAAGATACACTCTGCTTCCATTGAAGGCTCGGTTAACGGTGGCAGCCCGATAGGGACCAACCCAGTTGTAGTT
GGCGGGCTGCCTAGTTTAAATGACGTTCTTGAACGACGGCCTTGAGCTCTGGCGGGAGTTCCTCCTTCGTGCCTTTAGTGCGCACGAATTTGGCAAGGTC
TTGGAAGTTGCGGAAAAGTTCGCATTGTCCAGCATCGTGGAGCTGCTTGCAGAACTTGCAACGCTTGTTACAGTAGTGGGCGGAGTGACTCATGCCACCG
CACACCGCGCATGGTCCGTACTGTGGGCGTCGGTTGTCGCGGTTGAAGTCACGTCGACCGCGTTGGTCCTGATTGAACCCACGGTCACCACCTCGGCGAT
CTTGATTGAAGCCATTATCGCGATCAGGCATGTTTCCACGTGGTTGACGGTTGTCTGAACGTGCGTAGGTGCCTTCAGCAGCTGCACGGCGCTCATTTTC
GTTAGCAGCGGCGAGGTATCGGTCGTTTTCATCCAAGGAGAAATCACCGTCCGTATTATCAGGCTGAAAGTCGTTGTACTCATCTTGGACATTGTCGTAA
GCGTTCGGATCTTCGTTTGAATACTCGCTGCCTCCTTGAGCAGCTTCACGACCTTCTAATTCAGCTAGTAGGTCGTCCACCGTGGCTTCAATGAGTGTCA
CTCTTGGTTTGTTGCGGTTGTCATCGCGGCGACGGTCATCACGCCGGTTGTTGCGGGCGTAACCATCGTCGCGTCGCGTATCACGACTCTTAGAGTATCG
GTACTCACTGTCACGCTTGGCCATTCTCTCCTTGCCCTTGAGAACATCTTCGATGATCTCTTCGAGCTCGTGAATGTCGGCGACTCGAGTGTGGTCTAGA
CTCTCCGCTAGCTTGTCATCGTCGCATGTTGCCAGGAACTGCTGTACGTGTTCTTTCGCGTCGCGACCACTCTTCTCAAAGTGTAGACGGGCGGTCCGAG
CGTAGCCGTTCAGCCTGTTTATGTAGTCGCACAGATGTTCATTACGTTCCCGCTCGGCGGAGTAGTAACGCGACAGTGCCGTCTGCGTGAGCTGCGAGCA
GTAGTAGCGGATGAACGCATCGCTCAGCAGCTTTCACTTGCGCTTCGTCTTCTTCGGAAGTTGACGGAACCAATGAATGGCTCCGTCTCGGAGACTTAAC
TCAAATGGAATGCACCATTTATCGGCATTTGTGTGGGTTCCAGTCATTTCATAGACGAACCCACGGAGCCACTGCATACAGTTCTCGCTCTTGTTGCGAA
TGCCTGAGAACGGCGTGATGCGATCCAGCGGTCGGTGCGAAGCCATTTCAATCCTCGGTGTCGGGTCCACGTCGTTCAGCGTCGCTAGCTCATTCATCTG
ACGCATCAACTCGAGTTGAGGATCTTCCTCGTCGAATGTACGCACCAAAATGTCATCGTCACTGGACGAACCATCGCTGTCGACTTGACGACGTCCGGCA
CCACGTTTGGGGGCTCGCACACCGCCTCGGCGACCGAACAAACTCTCGTTACTTGCGTAAATGCGTTGCATACGGCTCTCCGAACGTGGCGTAACCATGT
GCGAGTCTTGAAAGTACGGTGAGGCTTCGGTAGTGCCAAAGGCACCACGCTCAGCTCCACGCTTGGTCGGAGGAGTACGAACGAGTCGTTGGGGCGTCGG
CGGCAGTGGAATCTTAGACGGATCTTCATCTTGAATCATCGGTCGACTCACAGGCTGCTTTCCGGCATTGATGCCAACAGCGCCAAACGCCTTCCGAAGC
TTCTTCTTCCATTTCTGGAGAGCAGCTCCGGCTTCATGTGGACTCCAATCCTGGAGCGACATCGTCGATGGGTACGTCTCGTTCTCGAACCCCAGCGACA
ACAGTAGCGAAACTAAATCCTCGGCAACTTGACTAGTCGAAACCGAGTTGACTGGGTATTGAAGTTCCTGCGCAAGCGCAGGCCAGTCGGCCTTTTTCTT
GGGGATGGGCTTGAACAGCTGCATCCACTCATCATTCTGCATCAGCGCTTGTACGCGGTCGAAAACGCGCTTGGCGGCTGGTGTATCACCGTTGATAGGT
GGGCGAGGTGCCTTCAGCAGTGCTGAATGCTTTGCACTCGCCACCGAAGGTTTAAAACCCTTGGTCCCATCGTCATAACCATCATAGGCCGGTTCCGGTC
CCGCAACATCATCGAGCTCGTCGGCGAGGTTCCTCGAAAGGGATTTGGTCGCCCCGCTCAGCCCCGATGATAGCGTGGCCGTCTCCGGCGTCGCTGCGCC
TGGCTCTGGAGCCGGCGTCTTATCTTCGTAATCTTCATAATCGTGGGCGTCAGGACCGATGTCCGCTTCGTCGTCGAAGCTCACTGAAAGCTCGGTGGCG
GCTGCAAAGCGCGCAGCCGGGCTTGAACTCTCGTTGCGAGCCCCGCCAGACTTGGCAGGCGTAACTGGTACCATTGGTTGTCCTTTCGCCATATTTCTTG
TCTTTTTCTTGTTCTTCTTCTCTTGGTAGCTCGTAAACTGGAAGGCCATACAAACAGTTCACAATGGTCACAATCTGTTCCCGGGTCGCGGCACCAGTTG
TGGTGTTGGAAATCCCACGTGAACTCTAGCTACAGATGTAGTTAGGATATTCCCACAACAATACGTCTACTAGGATAGTAAACGATCGTTCGGGCGGACC
TGAAGACCCCAGTTCTGCCCTTGCACCGGGACAAACTGGACCTTGTAAACTACTTATATAAGCCAACCAGTAAAATAAGAGCACGCTACTAGCACGAGCA
AAGCTAGCAGGTGTTTTGAATCCTCGTGGTCCCAACAGCGGAAGGGTACCAGGCACGGGTAAGCCTTTTACGAGATCACCGAGTGTTCAACACTCGGCTG
GAAGAAATAAAAGGGAGGCAATTCAAGCACTCCCAGTCGTGCAAATAGGCAACAATAAGCCGTCACGTAAAACCTCCCGATAATAATCGGCCAATACACA
AAGTCTCTTGGCCTTGCCGGATGAACCCTCGCTACAGAGCTTCGAGTTCACCGACAGGCATAACACACTCAAACAAGCTTGACCTGACGCTTACCTTGAA
GCCGGACGTCGCTCTGTGTGCTTGAGTGGAAATTCTGCTCTGTATTTAAGCTTACCCTTTCGGGTCTATTCCTAATAAGAAGTCCTAATCAAGTATACAA
ATATCAAGTGAACAATGATCCGTTATGGATCTTCTTGCATGCCAAGCGTCGTCTGCACCGTCGCATGAGCATCTTTAACGGTCCGCGCCCTGTCCCAGAC
GGTGAACGCACCTTCCAAGGGTCGCTGAGTCTTCCGCGAACTCATCCCAAC