Description :
From Genome Similarity Track
Location :
scaffold_42:532175- 546125
Transcript NameFunction/comments
g11350.t1hypothetical protein
g11351.t1 hypothetical protein PHYSODRAFT_462863

Sequence
13950 bases(100 bases per row)
GTGGACCACCTTGTGGAGTGGTCACCTGAATGTATCCCTTAGTGCATGTTACACTACGGTAGGAGGTGAACCGAATGTGTAGCCCCGCTACAGTGAGACC
CACCTTCAACAATCGAGCGTTGTAATAGCAATTATGCCATACTCGCTGTTGTCGGATCCATGGACGTCTTGGTTGCGCCGATCGTGAATTTCGTTATGTT
TTCCTTGATTGTTGCGGCTGTGATTTCCACGGCGATCATGGCGTTTCCATTAGGAGAACGATTGTTGTTTTCACGACCATGGTAGTTGGTCCACGAGGTT
TTTGGCATGGTTTCCCTTGTAGCTGCCTTTGCAAGGGTAATGACTTTGCGTGCCTTGTGTTGCCTTGAGCAGGAAGAACCGTGTCAGTCTTGATTTCGCC
ATCACATAGGTGACGCTGCAGGATGCAGCGGTCGACTGTGCCGTGGTTGTCGCGCTGACAGTACGTGAACTTCACTGAAGCCACGACAATTTTTTCATCT
TGGTGGGACTCGGAGATTCGCTGGCATCGGAATTGGTGATATGGCTTGAACAGCTCTCTCAGCTCGTGTTTACTTAGACTGGGGTTTCTTGTCCGAGGAT
GTAGCGATTGCGCGCTAGCTCATTCTGGACCTTGGTCTCGACGTGCCGTTTCAGGTCTTCGTACGGAATAAACTTCCGACTGCCTTTCCAGACTGCTAGT
TCAGGCTTCCACTCCGTTGGGAAGGAATGGTACAGACAGAGCGACCTTTGGTCGTCGCTCAGCACACTGTTCGTGGCTTCCGCGGCTGCCTTCATAGATT
CAACCAAGTCAATGATGAAATCCATCCTTCCTCGTATTTGAGGGCCATCAGGTACGGCTGAATGTAGTACGGGTCACTGCGGATGGCAGCAACTTCGTAC
TCCTTATCCTTCACCACGAGAACGTGTTGATCATCGATGGTTTTGATGAGGAAGGCTTTAGCCTTTGCTTCATCGAGCCGTAGATTCCTCGAGCTCAGTT
TTAGGCTCTTAGCCTCTAGCTTCTCCGCTCGCTTCAGATCATCACGCTTTTTAGCAGTGAATGACTGGATCAAGGGTGGTTGTATCTACCCCATTTCCAC
GTCGCCGTCGTCTCCAACGGTGGCAGACTTCGAACTTGAGTCGTCCATGTCGTTGGCCTTGGGTGCCCCAACGGCGTCTAGCGCGGCCTTAATGTCCTCA
TGTCCGCCAATACCGGGTTGAGGTCTTCATCCGAGGAGAAGTCGTAGTCCTCGTCGCCCGCATAGTCGGCTTCGAGGGCGGCGGTCACTCGAGTGTTCCA
GATCACGAAGTTCCGGCCACTGAGGCACGGAAAATCGTGGTCGTCGGTGCTTGAGTCAGTATTTGGGCTCATAGCCTGTCAAGGTCGTCGGAAGAGGAGC
AGCAGAGGTGAGACAGCTTATGTAACTAAGGTAAATTGGGCAACTTGGTAAATCCTACCTATAACCTAACCCCTCTTTCTTAAGACCCGCTTTTATGGGT
CAGATTGGCCAAAAGTCGGGAAAGGCACAATACTTCGAGCTTGCACCCAAAGTGCTCTTGGTTTTTGGCTTTCCCATATTCCGTGTACTTCACATAAACT
CGTGTAGAGCTTGATACTTCTCCGCGGGGAATTATTGCAGAATGTACTATCCACAGACCCAAGACTCTTGAAAGGAATTGCAGTAAAATATGATATTATG
TAGGTACAACAGTAAGGAAGGCTCTCTCTCTCTATATTCGATCATACATCAATTACGACTCTTCATGAGAATGGCGAAGCGTAGCGAAATGCCTCTAAAT
CGCATGGTAACGATTGGGGGAGCTTTCCTAGACGGCGCAGCTTGTCCTCCGATGTGAGGAAGCTTGTACTCGTTCGAACCACCGGCGCGCATTGTACACT
CGAAAACCTTCTGCAAGGTGAGAAGATATTGTCAGCTTCTCATGTTCGAGTGCGTCGTACGATTTCCTTACCGCACGAATAAGCTGGTCGATGTTGTAGT
AGTCTTCTTGATACTGGAGAGCTTGTATCGAAGAGAAGTATCCCAAATCAAGGGTATATAATGGGAGTTTGCCGGCTGAAACTCGAGATGTTCATCGTGC
ACGCCCAGCGGCGAGGATATCTGGATCATTGGGTTTGCAGTGAGATGTAGCATTATCATGTTGGATGATGATTGGCATACCTTTCTCACAAAATTGGCCA
TTGGCCTTGATTGCTGGTATAACATGTTCAAGCAGGTAGGCTTGTAGACTTTACCATTGGCAGAATCTGTAGCGGGGTTACACATTCGGTTCACCTCCTA
CGTAGTGTAACATGCACTAAGGGATACATTCAGGTGACCACTCCACAAGGTGGTCCACATTCATAGCCCAAAGCATATGACTGGTAGAAAGTAACATCTT
TCTACCAATGAGGGCCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTTATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTAC
AATCAATACAGTTCTCATTTGGCACCAAAACTATCGTTCGGTTCCTTTTATCTAGGTTTAAGTATACTTGCGGATACAAGTATACTGAACTTAAGTAAAT
AACTCCTACGCTTCCTCATACACGTGCGCACGCGTGTAAGCTTAAGCAGTGGGTCTAAGCAGACCCATTACAGAAACCAAGTTCTTCGTCCTGATCGTTC
CTGCCAGTCGGTTCTTGCTGGTGCGCTGCGCTTCTGTTTGCTTCGTAAAATCCCAGATGCCAATTTTCCGTCAAATAAAACCTGTCCATTTGCATCATAT
CTGCAAATAATAAAAACAATAAATATCAGAGACTGAACAAAATTGATAAGTTGTGCAGGTTACGTTTACCTTGGTCTAGCTATTGCAGCCAGGAAAATTG
TCTTGCCGATGAATCGCTTGCTTTTACGCTCGCGATGAGGCACGGTCTCCCTGGCAGAACGTAGAAGGCCCTCTTGTTTGTGTCCTCGTTGAACCACTTC
TCGTCCACATGCACGACGTTGTACGGGGCGAGAAGTGGGAGCCATCAGATCCGTGGACCACGTGGCGAAGAGCGTGCCGAATTCGAGCATGCTTGTTCTC
GTTCGTCAAGAGCGGGTGGATGGTGTTGGTGTGGCGCAGGAGCTGGCCCTGCACGATCGCGTCCCACACCACAGAGCGCGCTACGTCCAGCTCATCTGCC
AGACACTGTTGTGTCATGCGCCGACGAAACGGAATGGTGGTGATGCGCGCTAAAAGCGCTTGCCGGTCTTTCTTCTTGCGGCCGGCTGCCTCCGGCATCC
TGCTAACCACGCCGTCGATCCCGTCGCTGGCAAATGCCGACTTAAACAGGCCCCAGACTCGGCTAATGGTGCTGATGTCCACACTAAATTTCTCAGCAGC
ATGGCTCATGGCTCCTCTGTCGGGGCGACCGTGCTCACCGTTCAGCAGTAGAAAAATCATAGCATCCTTTCGCTCTCTGTCGGTGAGGTTTGGCTTGGAT
GGCGTGGTTCGGGCGCTCATGCGGGGGGACTGGTTGCTGGTGGCGTGCTTGCGAGATGGGGTAATTTGGGTAATGAGGATGCCCCATGCGTACACTTTCG
CTCGTAACTTTCTTGTTTGAAGGATTTTTTTGGCGCTCAAAAGACGCGCGAAAAGCTGAGAGCAAATGGCGTCGATTCCGCCTATCAGCGGGCTCAAAGC
GAGCCCATGAGGGAAAAAAGATCGGACCATCTGTTTTTCGTTGCAATTATTTTCACCCAGAGGAAGTATGACATTACCTTGTCATACTGTGTGTTCTCTA
CGTAATGTATCCATTCCGCATTTGAATGGAGACCAAGGCTCCACTATACTCCGCGACAAGATAAATCACCCACCTCGTTTGAGGGCACAGCTCTGTCAAT
ATTACGAGTTAGCTATTGCTGTTTAGATATGCTTCTTCTGTCACCAATAGACCAACGTGGTTTGTGCTAACGATTGCAATTTCGCAGCGTGCGGGGGACC
TCCAATACAAAATTCCATTTAAGCATAGCGACACATTAGATCACCCACTCGAAGCATACAAAAACCAAGTATAAAAGAATGACGGTAATTTCAAAAGTGC
GTCTTATTGCCTTTCTTATCTAAGACTTCGATGCATCTGCGTGGCATGGACTCAATGAGTGACATCAGCAGTGCATGAGGAATGGATTCCCAAGCCTCAA
ATAATGCAGCCTTCAATTGAGGCACACTATCAAATTGTCTTCCATTTGCATACACTCGCCTACTCATAATGGACCACAAATTCAAGAAGATAATGGAGTC
CCAGATGACCTCGGTGTCCTTGCACAGCAGCATGGCGCTGGCCCACGCTTTGCGTTTCAGCATGTCCTCGGGCTTGAGGGGAGCGTGTTCACCATCTTGG
TGTACACCAACCAGTCCACCCTTGCTAGGGTGCGCTGGATGGTGCGCACTGAAACGGTGAGCTGGAGCTCCGACTTGAGCTGGGCAGCCGACAACATGCC
CTTGGTAGCAGCGCGGATGAGACGGCGGGTCTCGCGGTCAGAGAGTGCCGGGGCAGGCCCAGGTCGCTTGGCTTCTTGGTGTGGCGGTGTGGGCGTCGTG
ACGCGTCTGATGGTGTGTGTGCAGCTGTGACGGGGCACACAGCACCTTGCACAGAGGAAGTGCTAGAGAGCGTAAGCTCTCGGTGAACAACAAGTTCACG
GTTCCCGGTCTAAGGGAACCGACTACGACTTAGACGGTAGGTTTAAAGACTGAATATATTTATAGGTGAGTCAAGCTTGATCCTTACAAACTCTAAGTCA
ACTATAGTAAAAGCTAAACAAGTGCCCAATGGTTGGCTCACCGCCAACCGGTACCACGTACCATGGGCACAAAAGAGAGACATCCCGTCACTCTTTATGT
AACATGGGTACACGTCGGTGTACCCCGTTACATCCTCCCCCACTTATCTGAGAATCACACCTTATTCTCCAATCAGAAGGGAGAGAATTGGAACTCCCAA
ATTGGGAATTCCCGGGCGCAGCCACAGCACGGCTGGCGCGCCCTCTCGACAGTCACGCAGTGACTTGTGTCCGTGGCGGACACTGCGAGGTGCTTCCTTG
CACAAAGGACGATGTCGGCCGCGAAGCCGCCGTCCTTAGCAACTCGCGTTGCAGTGCTAGCAAGCGCACAGTGCTTCGGCACGGGATGCTACTGCATCCA
AACTTGCGGTGGTTCTCCTTGACCACCTGCAGTTCACTTGGGAGGAGCCGTGGGCCCTCCCTGACACTTCGTGTGTCTTGTGTCTCCCGTGTGGGTCGAC
ACCATCCCGGGCATCACATAGCCCAAGAGTGGAGGGAGCTCGCAGCTCACCTCCTGCCATGATAGCGGACCCGCATGGGCCACGCTAGTCATGGCTGAGC
GCGTGAAGCATCGGCGCCGTACACGCGCTCAGGTCATTCGTTGACCAAAGCACTAAGCATCGTGCTTCGTCGTAGTGATACGACGGCTGCCATTAGCAGC
CTGCTCATCACTAAGAGCATTTCGGGTAGAGCAGCAAGCTCCACCCCGCGTCTAGGTCGTCGTACCATAGACGCTTCGGTGTCGGACATCGACACCGAGG
TACCCATCGGTACTTGAAGCATGGTGGAGAGTTACATGCACTCTCTACCACCTTCACTCTGGTGCCGGCGATTGCTTCGTGCATCGCCAAGACCAGGGCA
CGGTCGGAGTGTGTGCAAGCCTGCACGACACTCGGTCTTTTTCAAGACCACGATGGCGTACGGGCCTGTGAGCCCATACGTCAGTGGTTCGCCGTGTACT
ACGGCTACCACTAGAACATTGAGATGTTCCGAGTGCGTGCAAGCATGCACGGCACTCATCACCACATGTGACCGCGTCGGCGTACGGGGCTGTGCTCCCG
TACGCCAGAGGTACGCCGCGTGCTCAATGTACCACGGCTGCCTCAAGTGCCGCAAGCGTGCAGCACTGATGCTGTACAGTTGTTGGCTCATGCCAACAAC
AGCTTCCGTGAGGAAGCTAGTTTCTCTAGAGACCTGGGAGGAGAGGTATTTCCGAACCCCTCCCCCTCTTACGATCGATCCCCCTCCGGGGTGACCGAGT
CGACCGCGGCTGGAATTCTTCCAGCCCGGGAACAGTTTGAGTCTGTGCGACTTGACGTGGGAACGATATTACCCACGTCGGGTGAAGCCACCATGGGCTC
ACCTGGTGTGTGGAACTATGTTACCCACACAGGAAGCGCAACCCGCGTCTTCCTCTTCAGTTAAGGTCTGGGCGACCGGGCGCGATATACATTGCGCCAG
GCACGACGTCAACCATGTGACTCGTGCCGTGAAGTGAAACACTGGGTTCTTCGGAACCCAAGCGCAGCTTGCGCTTCGGCATACAAGGTTCAGCAATGCT
GACACCTCGGCCTGTGGTAGCAGCTGATAACCGGCTGCACCATCGAGCCGACCGTGTCTGAGGAGCATAGCTCCGAGTCGTTCATTGCGACTCCGGTCTG
GTACGTGCCCAGACCCGACTTTCGGCGGCGACGGTGTCGTCGGCGGTCATCAGGACGTGGAACTAAGTTACCCACGTCTTGGTGGCGGTGCCAGGAGTCT
TATCGACTCCGTGTGGAACTTGGTTACCCACACAGGAGGTGCTTATAGCAACCTCCAGCTGGCCACGATCTCGGCCGTGGACTTAAACCACCGGTCCGGT
AGTGCCACTCGGCACTACTGAAGTCGAAGCCCGTACGGCGCGACGACTTCTCGGCGATGGTCGCTGTGGTATAGCGCAGCCACACATGCCGGGCAAGACG
CCCTGTCCATCGGCTAAGCCTTTGGCGGTCCGCGAGGGTTACCCGCGATGGACATGGTCTTGCGACCTGTTGACGTAGTTATGCGTAACTACGTCAACAG
AACTCTTCCAGGACGTTCCTGTCCAGAACAGAAGAAGAGTTCAACTCTTCAGGAGAGGTCTCCGGTTACAGGAGTACTATCTCCCCAGCCTTCATGCTGG
CCTGGAAGTCGTGCAGCGACATTCCCTCGAGGTTCAGAAACTCTGACACCTCCGGCAGGGCGGTCAAACTTATGACCGCCGCCTTGACCTGACAGGTCTC
GCCGTCGAAGATGTGATAGCATCTTCGGCCGGCCGTGCCTGAGGAGCGTTGATTACTCCGAGTCGCTCGTGGCGACTCCAGTCTGTTTCAACAGACTCGG
CTTACGGCGGCGACGACGTCGTCAATGCCTACCCCGGCGTGGTTCTTCGTTACCCACGGCCGGTGGTGACTCAAGGGCAGAGTCGGGAATCTCATCGACT
CCGTGTGGCACATTGTTACCCACACAGGAGGTGCTCTCGGCAACCTCAGCCCTGGCCACGGTCTCGACCGTCTTGGCCTCACGTGGACTTGTTCTACTGG
GGAGCTGACATCCCCTGGCGCTGATACAGTCGAGGCCTGTATGGCGCCACGATCAGGAGCGGTGGGTGCTGCTGGCGTTGCAGCTCCCCTCGCTGGACTA
TTAGTCCTGTCCACCGGCATTGCCTGTGGCGGTCCATTGCCCGCAGTGGACGGTGTCTCAACACCTGTTGCAGCTGCAACTACTCCGACGACTTCCGTAC
GTCGGCGGACGCCATTGCGTCCTGGTAATCCTTTCGGATACCGTGTGTTCTGGCAGAGGTGGGATCATGACTCACCAATGCTCTGCCAGAAGCTGGGTGC
CGGTTAGCCTAGATGGCTTTCCGACACCAATTGCTTCAGGGTGCGTGCGTCCATGGCACGGCGCACCCAAGCGGACGCCGTACGTGTCCACGACCACGTA
CGGGTCGCAGCTGTTCAGGTATGTGAACCTGACAGCAAGGTCTATGCAGACCATTGCCGATGCTCTCTCACAGAGAGTTGGCAATCGCTCCGGCGGCGTA
CGAAAGCATTCGACGCCCCTGGAACTAAACGTTCCTAGGGATATTAACATCCCCGTACACTCACGTGTACTAACGGCAACCCAGCGTTGCCATCACCGAT
TCGAGACATAATGTCTCTCGTAGGCTAAGCCTCCATGGTGTGCGCCACCCGCACACCCGTCACGGAGACTCAACTCTCCCCCCTCTGGGGAATCCGCCAT
TACTGGTGGCCGGAGTTCCCTCGGCCACCTGGTCGCGGCTTGCGCCAGCGACCGTTAGGCCCTCGGGGTTTGAGGGATGGGTTCTTCCCCACCCCAGTCG
AAGGACACACGCGTTGGTAGTGTCCTAGTCCGCCGCATTTATAGCAGCGGACCGAGCCAAGCTCAGCAGAGCTTAAGTCCATAGGCTCTGGCTCGTTGTT
CGCAACGACAAGTTGCGCAACAACCGGAGTACCAGCCTGCTTATGGCTGTACTCCTCCTGGAGGGCGATCTTAATCGCCTCCTCCATAGTGGATGCATGC
ACGCGGAATAACTGCGTGCGTGCGGGACCGACCTTCAGGCCGTCCATGAAGACCGTCGTCTTGACGTCTTCGGGCAGGGGGTTCCCCACCAACGATGATG
CCAACGTGCGCATCTCTTGTACGTACTCGTACAGCTCGCGCTTCCCTTGCTTACAGGCGAGGAAGCGTGAGCGCTGGCGGAACGCATCGTTCGCCGGGAG
AAACGCAGCGCGAAGCCGCTCGCACAACTGTTCCCAGGATGCAAAGCATCCAGGAGACGTCGTCTCCAGCGTGTACGCCCAATTCTTGGCACGACCGCTT
AGGTTGGACAACGCGAACGCAACGCGAAGTCCCTGATCCGAGATGAGACCCGCCCTCATGGCGATCTCAACTTCTCGGATCCAGAAGTGAAGGTTTTCAC
CTTCCTTCCCTTCGAACGCAGGCACAGCCAGCCGCAAAGGCTTCGGCTGGACCGGCTTCGGCTCGGCCACAGAGGCCTGCAGGTTTCTTTTTTTGTTTTT
TTTTTTTTTTGTATTATACGGATTATTGTGTTACATGCTTTCGCAGAACTCTAATAACCATGCGCGACTGGCCATTCCTTCCTGTCACGTGCATCACCTC
TTCACACTCCGTCGCCTCTCCTCCTTCTTATAGCCCTCTGTTTATTGTTTGTGCCTCATCGCACCATCTTCTTCCTGTCTGGTCCCACCAGAAGCCGATG
TCGTTTCCTTGTCTGCTATCCGCCCCAACGTACAGCTCATGTGTTCTGTATTCCGTCGAGGCTCGCACTGTGATGCTCTGTTGTCTGTCCATGGCGTAAT
TGGCGATCCAATCCGCCGTCTTGTTGTGCTGCCTGTAGTGGTGACTCCAAGTTGCGACCCCGCATATAGCCGCCAACCGTTTAGTGACTCGATACCAATG
CTTCATCTTCTTCGATTTTGGTCTGTGCGTGTTCTTCATCCAACCGATGATAAGCGCACTATCACCAACCACATGTAAGTTGCTCCATTTCATTTCGACC
GCTTCTGCTAGGAGCCTTTGTAGCCCGACAAATTCTGCCACGTTATTAGTCATCGTTTGACCTCCCAACGCCGTCGCTGCTGCCCACAACAGTGTTCCTG
TCACCTGTCCATTCGAGACTGCATCCCCAGTCAGCTCCACGACCACGCTACCACTTCCCCCGGGCCCTGGATTTCCCCGGGAGCCTCCGTCAAATAGGCC
GATCCTCGTTGGGCCCGTCGGTGCTGTCAGTACCTTGCGCTCTGTTCCTACACTCCAAGCTTTGAGAAGATGACCCGCCGCGGCAAGTTTGGGTTTCGAG
TCCACCGTCAATGGATATAAACTCAGTGTGTAGCGCCTGCACGCTTCCAACAGCCCTTTTCGTAATCCTTCTGCAGCCTCCGCTAGTGTGACCTGCTGCG
TGCTTATCGCGTGCACGCGATTGACATTCCACCGCCAAATCGCTGTTACCGTTAAGGCACAGCCACTAGCCCATATATCCTGTGCCATATCATTATTTTC
CTCCCATTCCGTGTCTTGTTGTTGTATACCCCATTGAACAACCCAAGCCAGGAGGCATTTGAGCCGAAACCCAAAAATGTCCTCTATCATGTCCGCCCTG
AGCTGCTCTTGTGTACGTCCATCGTCCTCCCCGTTTCTCCACATGTGCAGCAGTACGTCCCAGAAAATTGCCGCCTCCGGGCATGTCCATATTAAGTGAT
CAGCTCCTTGGCGTGTGTCCCCCGCACATTTTTCCGCCCTGCAATTGTATTGTGTTTCCTTGTTGCACCACAATCTCAACCTCCCCCACTTTAGCTTCAT
CACATTCTGGACTTGATATGCTGGCACCCCCTCCATCTTTTGAATTCGCCCCCACTGCACTACGCATAGTGCGTCCGCTATCTGCTTGTGTTGCTTCCGC
CACTTATCTTCTATCTTGTCGATCGCAATCTTCGCTTTTTTATGCACACTACGCCGTGGTAACAGTACTTTGAATTGCTTCCTGGTCATGGACCACCTCC
TTTTGCCAGCCCAGAGTGGCCTCATTCGAGTTAACCAGGGGTGAGGGGTTACCCATAACCCCTGATCCGGAGCTTCAAGCCATCTCGCTGCCGCCTGGCT
CACTGTTTCTTTCCCTACTGCCCACGGCACCTTCTTGCTGCTAGACCCCCATGTGTGATGCAACTCCGGTGTCTCCCCTTTCACAACCTCAAAACTATGG
TGCTGGTCTTCTAGATGGTGATGTACTATCAGTTCCTCTGGTCGTCTTCCTTTGAACACGGTCTCTGGATAGTTGGCTATAATGTTGCAGCATAGCTCCT
TGAACAACTCTGCTACTTTGCTGTTCATTGGTATTTTGTGCTGCACTGGTCTGAAAATCACTTGACCCATGTCCTTCCAATCTATGACTACCAGTTCACC
TAATTTGACATGCGCAGGCCTGCTCACTAATATCGCCAGCTCTTGCCAAGTCATTATTCTTCCTCTTAGATCCCACATTTTCAGCGCTCTCAGCTCCACC
CCTTCCATTCCAGAGTGGAGAAAATCACCTCTCTCCTTTCTTCTTTTCCTCCTCACCTCATTAATTTTGTTCTTGATACTGTCACCACAGTTGACCTGGA
GCCCCTCTGCTTCCCACCGGAAAGTAACCCCGCTCGCAGCTCTCAGCTGCATCCGTATACCGCGCCCTTCCTCATCCTCTTTGTTTTCGTGCTTCACTCC
ATTTGTCATCGCCCATTGCACCCATGGCCTCCCAGTACTCCAGAGATCATCCCCAGGTTCAGTGGTGGGCTCTTTCACTTGCTGTGATATATGACCCTTC
CACTCTCCTCCTCGCTGTTGCAGTAGATCGCCAGTAATCTGCATCAATGTGTTATCCGTCATTGCCCATGTCGCCACTGTTGTCGCGCTCATCGCTACTA
ATTCAGCTTCAATATTTGGCAAACCAAGACCTCCCTGTTTTGCTGATCGTTCCGCCAAGTCTTTCTTGATCCATCCTGCAATTGTGGAGTCTGGTCTAGC
AAAAGATGACTTCCATACAAAATTTCTTATCCGTTGATCTGCCTGCTTGATCACGTAACTCGGCGGCCAAGCGTGCCTCGCAACATATAGCAGCTTGGGC
ACTATAATTGCTGCTGCGATTGTTGCGCGCTGCTGTGCTGTATTTGTTTTCTCCTGTGCCAGCGCTAACCTTACTGTAATTGCACGGAATGCACGATCCC
ATGCTTCGGATACCGTGTTGCCTGTTCCTGCGAAATGCCCCAGGTACCGTGCTGTGTCTACTTCCGTAACCACCTGTTGTGTCTCCACTGCTGCAGCCTC
GTCGTCTTCATCGTAGTGGAAATCCTTCTCCGATCCTAACCGAATCGCGACTGTTTTGCGCACACTCAGCATCAGTCCCGAAACTTGCGAGAAGCGGCCA
ACGGCATTTATTGCAGCTCTCTGCATTGCTTTGTTTGCAATATAAATTGCCGTGTCATCAGCATACCCAGCTACCCTTAATTGATGTACCAACTTGCTGC
TCGTTAAAGGCGTTCCTTGCAAACAAGGGTCCATCTCCACTTCGTCGTAAAGTAGGTCCACTGCAATGATAAAGAGTAGCGGTGCCAACGGACACCCCTG
GCGGATTCCGCTTGTTACTCCGACCTCCCTCGATAACTCGCCGTTTGCCAGAAACCTTACTGTGGTGTTTGTGTGAATGGCCTCCACGATCCTACAGAAT
TTTTCTGGGAAGCCTTTAGCTTTTAGTACAGCATAAAGAAATTCCCTGTCTAAGGAATCATAAGCCTTGGCGAAGTCCAGCATCAATACTTGTGCTTCTG
TCAGCTCTTCCCCATGTTGGCATGCGTGCTTAGCTGCTTCAAACAAATCGATCGCCTCATGGATTGTCCTGCCGGGAATAAAACCGAATTGTGTGCTATG
TACTATGCTCGCAATACGTTTCCTCAGCCGCCACGCTAAAATCCTCGTGAAAATCTTATAGTCTGAATTCAACAGAGCTATAGGCCTGTAGTTCAGCGGG
TTGCTTGCATCACCCCCTTTACTGATACTGAAAATGAAGGCCTCTACGAAAGATTTCGGTGTGACTCCTTCCTCCATGGCACTGTTGAAGATTGTGAGTA
AAACTGGTATCAACTCCTCTTGATTGTCTAAGTACCAGTCGTTGCTCAGTGAGTCTGGGCCGCATGCTTTTCCGCGCTTGCATTTTGCTATAGACATACT
CACTTCCTCTGCTGTTATCGGTTCATCCAATTCCACGAGATCCACTTTCTCCCATCTGTCCTGTACTCTGTTGATGTAATTGTCTCTCGTTTGATCGACC
TCCGCCACACCATTGAGAATCGGTTCCCAGCTTTCGGCAAGAATATCCGCTTTTTGTTGTGCATGCAAAGTGGAGCCTGCTATTGTTGACTGCAAATGCG
GGATTGTATTATCTCCGTACTTCGTGCATATTCGTCGATAAAATTGCTTCGTCGTTCTTTTGGAACTCCAAGCATTGCTGGCAACGAGACAGCGACGTCT
TGAAGCACCTCTTTCCCCTTGCACTTTGGCCAATTCATCCAGCAATTGTTGTCTATGCAGCTGGTGCTCCGGTTGCGTATATCCACACTTCCCCAACTTG
ATCTTGATTCGTCTTATTCGTTGCCTGAAGCCTCTTGTTGTTCTGCGCCTCGCCTCTTTTTTAGCTGCGTCATTTCTCCTGTTAGCTCGCGCTTGAATTG
ATCCCACTTGACCGCACTGCTTTCTTCACCTCCACTCTGTCTTGATGCCGCCAGCTCTCTTAACTTATACTCGATCAAACTCTTGGTGATCGTTTCAGCG
TACGGCGGCGGTGGGTAGAGTTTTGGCATCCGTCTGATCCTGACTATTCCTCTGGGTGAATGGAGCTCTAATATTACCCCTCTGTGGTCCTCTTGGCAGA
AGGACTTCACTACTTGTATTCCCCGCAATATTTTGCGATCCACAGCGGTGATATACCATCGGTCTATTCGTGATGACCCGATCATTCCATCTGCCGCTGG
TTGCTTGTGCGTGTGATACGTGTCAGCATATTTCCTCCGCTCACTGTAATTGTTTTGTGGAATCGTGTAATTTCCTGCATCTTCTAGGCCATTCAGCTGA
ATGACCTGTTCAAGCGCTCTTGCTCCCATGTCATCTCTGTTGCAGTTTCCAATTCTGTCTATGTTCACGTCGAGCACACAGTTGTAGTCTCCTCCCCATA
TCATCGATATACCAATCGGGAAAGGTATCCTTCGTAAATTGTTGAAAAATGCGATCCTTGCCGGCCCAGCCGATGGTGCATATATGTTTAGGAAAAGGAA
TGACTTCCCTCCAATGATCCCCACTGCCATCATGAGGTGCTCGTTCCAGTACTCTGTACCCCATTCTTTGACTTCCTTGACCGCTCCGTAAGGATTGACA
AGTATGGCTACCCCAGCCCTTCTATCGGCCCCGGACGACCACAGCGAGTACTTATACGCCGCCGTGTGCTTGTATCCCCACATTGCTGCATACTGTTGCG
CAGCTGTCGTGTTTTCTTCTTCCCTCAAATGTGTTTCTTGTAAAAAGATC