Description :
From Genome Similarity Track
Location :
Scaffold_70:53217- 54468
Transcript NameFunction/comments
Sapdi_VS20SDRG_14312hypothetical protein

Sequence
1251 bases(100 bases per row)
GGCCTTTTCCCGCGACAGCTTTTGGCGCGTCGCACACTGGATCTTGAGAATGGCGTCCATGTCCACGGGCGGCGGCTACGCATGCCATGTTGGTTGACAG
ACAATATTGTGCACAAACGAATACCGCATTGGACTGTGCCACGCGTGGGACGAGGGACACAGGTGCCTAATTCGATCGTGAGCCTTGGGTGAGATTGAGG
GCGTGACCTTGGTGGTGCGGGGGGTGCTCGACAGTTGAGGCAGTGGTATCTACAGCATTTGCTCGCACAGGCGTCAAATTACACATCGTAAGGCTACCTC
GATGGACCGGGACGTGTCAAGGGCGAGGAGCAAGTCTTCGTCGTCGTGCTGGTTGATGGCGCTGAGTCGCCGCGATGTCGCGACCACGCCCCCCGGGTTC
ATCACATGATCGAGACGGACCAAGATGGATTCACAGAGGGGGACCCACGCGCGTTCTGGGACATTAGCGCACAATAAGATTTAGAAACGTAGTTGAATTG
GAAGAGTACCGTAGACAAAAGCGAGCACGTGGGGTCCAAAAAGGGTCATGATTTCATCTTCATGGACCACGGCCTGCGTCTCGACGGCCGACTGCGGCTC
AAAGAGCTTGAGCTGCAGCACGCACGTCGGCTCGATCTGCGCCACGTAAAACGACACAAAGTAGGTTAGTGCGTGGTAGTTCCACGAGCCGCTAAAGACG
ACCGTGTCGGGCGTCGGGTCGGCGCCGTCCATGCGTCCATCGCCACCGTCGCATCCGTCGTCTACATAGCACAAGACAATATTTCGTTATAAAATCCAAG
AGTACCTTGTAACACAAACACGTCAGCGGGTCGCGACCCCGGGACGCGCTCCAGAGTCTGGTCCCGCACCTGCGGGTTCGTGTCGTCCATCTCGAGGTAC
ATGAGCAGGTCCGACGTGTCGGCACTGGTTTCGGCGCCGGGTTCGAGCAACTGGGACGTCGATTTGGCGCTAGGTTGGTTCTGCAAACTCACCTACACCC
ACTGTGTTATCAACAGTTAAAGAGGGAACACGGCGTACGGTCTCGAGCACCCAGGCGCAGAGGACGGCCGCTGGCGTAGAAATGGGCACCAAATAGGCGG
GTCGGAATTTCTCGTTGGTCAAAAATGGACTCAGCGCCTTCATTTTGAACGCGGCGACTGGAGGCCCGTCGAGAAAGGTGTGGAGCGTTCGAAGCAGTTG
CTTGCCGTTTGCGAGCAGTGTCCGGGCCGTGGACCAGCTCACATCTTTGGG