Description :
From Genome Similarity Track
Location :
Scaffold_49:5321- 7252
Transcript NameFunction/comments
Physo_136863hypothetical protein

Sequence
1931 bases(100 bases per row)
AGATTTGCACGCTGCTAACACGCGCGCTTTTGCGCTTCTTCAGGTAGCTCACATACAAATCACTGGTTCTGCCCAGGTGACAAAACTTATGAACAGCTAA
TCCCCATACAAAATCCTATATCAACCAAAACCCCTTACAAATGATACGACTTGGACTTTGTATGAATATGCTTGCAGAAGTAGCGCGCAAATCTTGAGAG
CTTGTTGTACTTCCTGTGGGAGGTACATCAAAATATACAGCCGGGAATATTTATCAAAAGTCACCACAAACAGGTGAGGTTTTATCAAAAGTCACCACAA
AGGTAATGATTGGCTATTAATCAGATCACTTTACAATCGACGGCGGAGCTGCAGGGAGCGCACCCTCCCCCTTGACGGCGTGCACCGTGCCGCTAGCCAG
CATCGCCTCCATATCATGACGGTTCCGACTTCTCTACATATTCCGACAAGTAGGCAATTGGTCAAAGCCAGTGCAAAATCGGAAATAGTGAAAAATCCGA
AATTAGATATTATGTACGGTAAATTAGGACTAGGGGGCCGTTTGACCAATTCTTGTCAGCTTTCATGCGGTGCTCACAGCCGCGAGGAAATCGCCTCTAG
AGGCCTGTGGGCCGAGAAAAACGGCAATTTGCATCTAGGCGCAAAATCGACTCGGGGCAATGTGCTCTCGAGGTGGCAAGTTCATTAATGAGAGCCAGGA
TCCTGTGGTGGGTCCACTATTTGGGTTGATTGTCTTTAAACAGTGATATTTACACTTCACAAGAGTGACCCTCTCTTCCAGAGCCACTCGTTTAAAAACT
TCAATGAGGTTTTATTTAAGCCAATAGAAAAGCGCCACGCAGTCAAGCTCTCGGAGACAACGCCGACAGAGGCCCCGCGGCTTCAGTCTAGATTTTTTAA
GCCGAACCCCCCAGACCGCAAGCCAAGCCGGAGGCTCCACCCTCGACGACGAAGCTCAATGGATGAGCGCAGGGCTTGCCCTGAGGAGCGGGATCGAAGC
CCGCCGTCGCCAATCACGATTGATGGGAGCCTTCCAAGGTGTGCAGTGTTTGGGTCCGGGCAAGCGGCCACGAGCGGATGGAGAGCGATGCGCTGAGTGC
CCGATGGTCTCTGGACGATGGTTGGCAGGATGGTCATGGCCTTGATCTGCGCGTTCGTAAGCTAACTGTCTTGTATTTGTTCATGAATATATGTATTTGC
CCCGAACTTTGTGCCTTACACGTGTCCGACGACTTGTAGTATGTTTTGGGTTGCAGCCGGCGCTGGGTCGACGATCCTTTCCAGGGCGATGTGGCTTTGA
TACGCCACGATGCGACTGTCGAGGGCACCAGACCGATGAAGCTTGCGTATCTCGCGCAGCACGCTGCCAGCTCCTTTTGCTCGGGATCCCTGCTCGCTCA
AGAACCTAAGGACCGCTGCTTCCGCGCGTTTTCCTACGTCGAAGACTAGATCTTTGAAGTCGACAGCATCCTCGCGCAGCACGAATCCGCCGTCAAGAAA
GAGCTTCATGTACGCAACGCCCAGGCGGTAGTCGGACTTCTTCTGGCAGTCGCTCGAGTCCCAGACACGGGGCAGCCTCGTGTACCACTCGAACCACAGC
GAGGACAGGTTCGTAGCAGCTTTCTTTCTTCGCTTTGCGGGTGGCGCTTGCTCTGACGACGCTTGCTCTTCTGATGCTTCTTCAATACGCTTCACAGGCG
GCGCTTGCTTTAGGATGATCGTCTCCAGTGCGAGGAGGCGCGCAAACATGAGCCGATTGCTCTCGATAAGCTCGCTAATGACAGCCAAATGGTGACACCC
AGCATGACAGCAGTTGCTCTTTGCTGCCGACTTTTCGTGTGCTTGTTCAGGACTCGAAGCAGCAGACGTATTGATTGACATGGACCAAGACAGCATGTCG
GCGACCGGGATATCAGCCGCTCCCAAGCATT