Description :
From Genome Similarity Track
Location :
Scaffold_1146:5320- 7349
Transcript NameFunction/comments
Phyag_g9668hypothetical protein

Sequence
2029 bases(100 bases per row)
CATAGGCTGTGAACCGACTCGGGATAGTCGGATGCCACGAAAAAGCCTCGTAGAAGGCTTTCAAGTTTATCACCGGAGGTTCACGAATGATCCGAGTGTA
CAGCTCTGGTGTGTCGTCTACTTCCACGACGTACTTGGCACATTCTTGCAGACTAACAAAGCGCCCACAGTCTATAAAACTCTCAGGGTTAAACAGATTT
GCCACCGTCGCGGTGTCCCCCAAGAAAACTGGCACGCTACCCGCCAGAAACGCGTTCACCATCTTCTCAGTCACgtatcctgcagctcgcgtgTTCTCAA
AGGCAATCACGAATTTGTACGGACCATATCGACGCACTGCATCGTCATTGTAAAATAAGGCTTCGCGAGATGCCATCTTGGTGAGGTCAGGTGGTCTTGA
AGATCCAGCACACTTTCCAAGAGCGTCAACAGGCCGAAGAGCGTTAAGGATATCGTACATAAGTTCGCGATTTCTCCACTCACAGTGAGCGTACAAATAC
GCACAAAACTTCGACTTCGGCTCTCGCCATCTCGATTCCGATGTAGATAGTAGCGATAGGGGTCCATGGTCTAGTCGCTCAGCAAACGATACACTTGCCA
TCGATAGATGAATGTGCTTGGTTCGGTTAGGTTTCGCAACGGTGGAGACTAACAGCACTCGCTCATCGAGCCCGTCGGTACTCCATGCTTCACCTGTAAT
CATCACCAGTTCCGTCGACCGATGCATCGTTGTTGTAGTCGTAGTATTGGTTTGATTTCGATTGATGTAGCGTTCGAAATAGGAAGCAACCATCTCTCGA
CACGCAGGTTGGCTTGCTGGATTGCACTTGCCTCCTAGAACACTaaacacgaacacgtcgGGAGAGCCTCCGTAGTATTGGTGCAGTATATTTTCTGGTA
TCACTAGCACAGGTCGATGTTGGTCTTCAAATACGGAGACAAAAAGGCATTCCAGAACAACTCGAGAGAACGTGGCACTTGGTGCATACGCAACAATAAA
CGGCGGTCTGTACATGTCTGCATCCAATAGATTGTATCGCCACAACTCCACTCGAGATCGATCGACGATATCCGCACCATGTAGCTGCTTGTAGTAAGTT
TGAAGTTCATGCTTCGCTTGTCGCGTGATTTCTAGGCACGATAGATTTCTGGTCACACCGGGAAAGTTGAGTCGAGCAATCCCACAAATCCTTAGGAAGA
AGTTGAGTTGCGTCTCGAGCGAAAGGAAGTACGACACTTTGATTCCCGCTTGGGACCTAGTGGAGAGTACTACCTCGATCTCGAGACTGTACGCTACTGT
TAGATCATGCAGTAAAAATTCAAACTCCAACGTTTCGGTAAAATTCGGGAGTCTCTCACTTCCTTTTCGGGGACTCAAGCTTCTAGGTTTCATCCAAAGG
TGGTAATCGAATCCATGACACAGTCCACGGCGCTCTAACAAGTTATCGTGAACGATTCGAATTGACAGCGGCGACAAGTCGCCAAGTGCCACGAGGTTGT
CGGCGCACGGTCCCCCACGCAGGTGCTCCAGTTTGTTGAACGGCCTCGCATGAACCTGAATTGTTAGCATCCAGAGCGCTACACTCATATCGTCCATCCC
TGCTAGGTAACTCAAACGTCCACGGTTCTTCGAAATAAAGTGCACGCAGTCCATCGAGAGGAAGAAATACGCCCCGATTGCAAATGGGGGAAGAGCGGCC
ATTGGATACTGTTCCTCGGTCAGGAAATATCGGAGCTTGCCGTTGTTGACGCGATTGGGCTGCTCGGTCTGCCCGTTCTCAATGGCGCGAACTTGACCAC
TGTAGAAACGTGCTCTTGGTGCTTTCGACGTCAACTTGTCCACAATTTTATCCATTCGCACATAGAGATCGTCGTCCGCAATCAATACATATTGTGCTCG
AGGGTAGTGCGTTGCTGTAAAGTGCATGAACTCTGTCACCTTTTTGGCCAGATCAGGGTACGAGTCATCGCAATCCAGCTCGTCTGTCAGCAAGTCCCCG
TACACCAATTTCTCCAGTTGAATGGCGTC