Description :
From Genome Similarity Track
Location :
Scaffold_666:5320- 6707
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_666-snap-gene-0.10Syntaxin 72
Pytap_DAOMBR444maker-pag1_scaffold_666-fgenesh-gene-0.1Mitochondrial Protein Translocase (MPT) Family

Sequence
1387 bases(100 bases per row)
CCaCCTAACTTCCAGCCACGAGGAGGAAGATGAGGATGGCAAAGAGGATGAGGATAATAACGTAGAGCTTGAAGTTACTGCTcTGTCTTGCAACCTGAGC
TGCTCGGGCTCCTTCGgTCTCGAGTCCATCGGTtGCGCGAGAGACATCATGGTCAATATCATCCAGCAATCGCACGTGGAGAGCTGTTTCGTCTTTCATC
GTCACGCTATAGTTCTTCAGGTTGGAAACGCCCTTGCTGATTAAGTCAAGCTGCTGGTCTTGGTCTACAGTAACATCATTgTATAAGCCTCCACGTCGTG
CGCTTGAAATACATCCGCCTTCCTCACCTTTCATGATCTGCGTCTGCATCGTCAAAAGCTTCCCAGCCTGGTCTCGAGGCAAGTTGCTGCATGGCAGCAC
CAGCTTgaGGATCAACCAAGATATTAGCGTACAAGGGTACTTCAACTCACTTGCTTCCATTCATCGCACTGCGCTTGTTGTACGCGTCCATATCGGATTT
CTACAGCGCGAGCAAACACCGTGATCAGCTCGTGTCCAAGTGCAGCGTACCCATCCAtcGTTTTCGTCCGCACCTGATCCTGAACAAGCTGCTGAAGCAG
TCGCTCACGACGGTCCATCTCCTGCTTTGTTCTATCGCCGCCCACACACACAAGTCAGGCCACCGCACTTCACTTTTtCCtCCcTCcATCCAAaGCCACT
CACACACTGGAGCcTGAGGAGCGTTTGAGTTGGTCGAAATCaCGCTTGAGCCGCGACACCGtcTGCTGCAGTGCGAAgaCGCTCGTGCCGGCCGCCGCAC
CATTGCCCGAGCGGATCTTCGACGCCAACGCGTTCTGCTGCCCTCGCGCGCTCTCCAGACGGTCGAGCCACGACGCCCACGCCGCCGAACTCATCCCGAT
ACTCGGATCTTCCACAGTCGGTCGCTGCTTCTTCACTTCCCGACTTCCAGGGTCTAGTATTGgaTGTGGCGTGGGTGGTCCTTTtCCGGGACAATGCGGG
ACGCATGATCCCTTGTTGCAGTGTCTGTGTGAGGGACTTCGgaGCTCTTGGACATCCATCACCCGAGGAATTGCCAACACCGCACGACACCAAGGTCctC
GTGAGCCAAGATGAGCCAGCGCGAGTTCGAACGCAAGATGGAGGAGCACATCGAGGAGATGCGCGTGACGCAGACCATCGCGTACTTCAGCCGCACCGTC
GAGCTCTGCTTCAACGAGTGTGTGCACTCGTTCCGCAGCAAGAAGCTGGATGACAAGGAACTCTCGTGCGTCAACGCGTGCGCTGAGAAGTTCCTGCGCC
ACACCATGCGATCGTCGGTCCGACTGCAGGAAAGCTACGCAGAGATCATGCAGCAGCAGGAGCAGGCCGCGCAGCAGCAGAAGTAAA