Description :
From Genome Similarity Track
Location :
Scaffold_1395:532- 3892
Transcript NameFunction/comments
Phymu_g13215hypothetical protein

Sequence
3360 bases(100 bases per row)
CCGCCTAGGACAATGGTCGGCACTTCTCTCGCCATGGACGCTCGAGATCACGAAATGTACGAAGGGAGAGGACGAAATACTGGGGGTGATCGCTGCCAGT
ATCACGCCTAGATCCGAGATCGACGAAGCGTTGACCGCGATCgcgcccaagaaggagcCTAAATGCCGGATCCAAGCACCCATCCCCACGGTGGACCGTG
ATGTGGGTGGTAAGTTTTGGCGGATCAGCTCGAGTgaagcgaggtggaggtgctTTCAGTGCGATCGTGTGGAAATTGCCTGAGTGGAAGGTGATCAAGG
CTAGATTAGGGTACACCGAGAGCCTCACCGTCAATGAAGCCGAATATAACGGCCTGCTGCTGGGACTCGAACTATTGAAAGGCCTCGATCACCCACGCTT
GGTGATCTGCGGTGATTCTAACCTCGTGATCAGGCAGGTCCGTGGTGAAATCGACTGTAAAGCACCGGGGCTAACGCTATTGAAACAAAGATGCCTCGAT
CACCTGAGAAATGGGGCGATCACGAACTGGTACATGTGAAGAGGGATTGGAACGGGGGTGCTGACAGCCTGGCGAGCGCAGCCTTGCAGCGACAAGGCGG
GATCGAGATCCAGAGCGACGCTGACTGCCAGGTTCTGATTACCCTGAACCGGTTGGACGAGATCCTAGTACCTAAGACCAATGATCCAGTGGTGCGAGTA
TCAGCCGTGGCTACGCGAGCCAACCCCCGCAGAGAATCTGAGGCCGCGTCCTGCGGGAAAATTTGACCAGAGATATGCGGATCGATCGGATTAAGCGGGC
acgagacgaagaaatcTGGATCGCAGGGATGAAGAAGTATCTGATCGGGCAGATTACGGATCTTACTCAAGCCGAATCGAGATCTTACAGCAAGATCGCG
GCAGATTatgaggtggacgagcacgaTCTGCTCTTCTATTGCCCTCCCGTaacgagatcgagcgacCATCGCGAGGGGCTAATGAGACTGGTAGTTccgg
aaacgctgcagcaagatgtTCTACACCACTACCACACCACCCTGGAAGGAGGCCACCAAGGAATCGGCCGCACCTACCAGCGAATCCGAGATCACTTCCG
CTGGAGAGGTCTCTATCGGAGTGTGCAAAGATGTGCCGGCGAATATGTGGACTGCGAAACTGGAAAGGGAAGACCGACGATCCAGGGCGAATCTCCAGGA
AATTTACAAGCCACGTACCCATTCCAGATTATAGCGATGGATCACATCCCTTCCCTACCCAGATCCAACAAAGGCAACACCGAACTGTTGATCTGGGTAG
ATCTGTTCACGGGATACGTCGCGATCAGCCCAGACCATCGCAGAATCGTACGAGGAATGTGTGTTCCGGCGGTTTGGGGCGAGCGAGATGATACGACATG
ATCGAGAACCTGGATTTATGTCGGACTTCTTCAGATCGTTCAACAACATCCTGGGACAGCGGCAGCGGGCTACGATGGCGTATCGACCTCCAGCAAACGG
ATCGGCAGAGCGATTGGTTCAAACAGCGACTCGAGCACTCAAAATGTACGTTCAAGATTTAGACCAGAGGGACTGGGACGAATACGCAGAGCGGTTGATG
TTCGCGATTAATACGGCCCATGATCGAGTCCGGGGAGACACTCCTCATTACTTCGTACATGAGTGGGATCTGAGATCCACCCTGGAAGCAAGTATACCAA
TCGGATCTACCAGGCGCCAAGATTGTGATCCGCGCAGATGGCACTATAGGATTCAGAGGTACTATCAGCAGTCGCGAGAGCAAGTCAATGCCAGATTACA
GGTCGCAATCTCGGATCGAGCGGACATACACAACGAGAACGTCGAACCGCATCGGATCGAAGTTGGATCTCGAGTCTGGCTATATCTCGATCGGGTGAGA
GAAGGCTACGCCCGCAAATTAGCCCATCTCTGGCATGGCCCATTCCGAGTCGCCGAAAAGATCAGTGAATTCACGATCAAGCTCGAGATTGCTGGAACCG
GATATCAGATATTCCCTATCGTCCATGTCTCGAAACTGAAATTGGTGAGGAATTTCCCTGACCGACCTCAGATCGAGCTGACAGTGGACGAGGCGGatcg
cttcgacttcgatgAGGTCTTGCTTCCGGAGGATAGCTGGGCCCCGGAtctcgaagccgacgagtacgaagtcGAACGGATCTCGGACATGTGAAGGGGG
AAAAGAACCCGATACGGCCAAATCTATCGAGAATTCTTGGTACACTGGGTGGGGCATGAAGAACCGAAGTGGGTCGACGAGGCAGATCTCAATTGTGGAG
CAATACTGAGTGCTTTCTTGCGAGATCACGTGAACCGTAACTGATTCGGCGTGATGCAGTCACATGAAGAGGTGTAGAAAGGGAGACGGCGAGTCGAGGC
GGTCGTCTCGCCGTGATCAACATGGGTAATCTGGAGGACGATCCAGATCAGGAGGGGGAGTTTGCATTTTTGTGTATGTATATGGAATCAGGagtggtcg
aagctgtcaGATGGTGTTCTCGAGTGGCTAAGTGGTGACAGAGTGAGATCACGGTACGATGGCAATGGAAAAGATAAGAGAGGTATGGATCACGTATGGA
ACGTTCGAATTAGGAGAAGGAAGCAGTAGAAAGCTCAGTGGGGTCTTGAGACGTGCGATGTCGAGGTGGATCCATAACTACCCTCGAGGAGTTGACTCGG
AGCATCGAATTGCGAACGGAGCTGGGGATCAcggtgcagctggaggcgcagGTGGGTTGAACATGTTTGGAAGACGTGCAATCCGCATAGAAGGGTGATC
GGCCGGGAGATCACGGTAGTGGTTCCGCCAGGGGTCCTCCCGGTCACATTCCGCGAGAGCAGTGATCAAGTCCGTGGGCTCCGGCCGATCCAGGTTGGGA
TCGGCCCGATTCGccgatcgagaagctgatcCGGGGTACCAATGGACCCGATCTCTCTGGGTAGGCAGATGCAGGAATATcggatcgagcagaaggTCGA
TGTCGGTCCATAAGTTCCGCATCATCGGGAGAAAAGTGACCAGCAACTGTCTCCAACGATGACCGATCCAGATTCGACGTTTGCAGCGCGCCTTGTGGTA
CTGTTCGAGAACCGGATCGACCCGACACATGGCACCACTGATCTCGATGTAGTGAGTCGATTCCTAGTACGCCTGAAGGTGGATCGACACGAGACCGGAG
AAGGATGTCGCGATCCGCCACAGTGGNGGCTCCAGTGATCAGGTCGGATCGATACCCGACCACCGGTTGCGGAGGTGCCACCAGCGGATCCCGCTCTGGA
TACAGAAATCCTGGCGGGATCAGCAATCTCTTGGTGAGGGTCGCGTCGACCATGGCGATG