Description :
From Genome Similarity Track
Location :
scaffold_383:532- 1933
Transcript NameFunction/comments
Plaha_PHALS_01589amine oxidase-like protein

Sequence
1401 bases(100 bases per row)
AGTGCGTGTGTCACTTGAGCAGCAGCCCGTGTTCCTGTGTCAACGGCAGCATGCACCGACATGCCGGGCTGCTCGAAAGCTGTCGCTTCGCCAGCGAAAA
AAAGGCGATTATCTACAGGTGCAGCAAGTTCAGATGAAGCCGAGTCGGACTGACCGACCCGGGGATATGCGTAGCCTCCACAGATCCACGGCTCGTCACC
CCAATCTTTGTAGATGCCCTTAACAAAGTTTTTGCGTGCGGGAAACGGCTCATCCACCGTGCCATATATCATATCGAGCTGGTCAAGAAAGCCCTCTACT
ATCTCGTCATGATCCATGCCAATGAATTTCTCCGCGTATAGTGCACTGGCAAATCCTGTTATCAAATACTTTGCACCGCTATCTGCAGACTTGTCGGTCA
CATTGGCGACATATTGCTTGTCACCATTGGTCTTTAAATGGCCGATGCCTTGCGTGGAGTTGAACCAGAACTCAGGCAAGAAACAGTCCGAACAGATAAC
ACCGTGGGCATTTTCAGGCCAAAATTGCCCTGACATGTGCAAAATTACCTTTCCCGCACGGCGCATATCGAATGACTTAACGGCATTAAGCTTTTGCTGT
GGAAGAGGTGGAGAGTAGGCAATCTTAGAGAATACTGCAATAGACACAGTGACAACCAGTGCCTTGCACAAGAGCTGCTTGCCGGATGTACTAGTCAGAA
GAATGCGGTCACTCTGGGAGTAGTCCACATTAGCAACAGGCCAGTTGAACCTAGTCATCACACCTTCGGCAAAGTAATCAATGAAACGCATAAGGCTTGG
TACAACACGATAATCACCGTCGTCCTCCAATTCAATCCACATCTTTTCGTAGCGGCAAGTAGTGCGCTGTGATATGTTTTCTAGTGGCCCACCAGCAGTA
TTGGCATATCCTGCCTCACAAAGCTTCATCATGGAAGAAGACAAGCCCACTTCACTGAAATAATCCCTCATAGACTTGTCATGTGGGATATTGTCAATAT
TCTCGAGGGTACTCAAGTCAGACACTGACTGGTTGAGTTTGATAAAttcctcatcatcatcatcgtaCATTAGCATGCGCTTTTGGTCGCCGATAAAGTA
GTAGCCGATGCCACCATCCGGTGCCGGCTCGGTCGGACCGCCATCACCCTACATGCGTTAGTTTAAAACGAGTGATAAGTGTGATCGCTAAACCATACAT
AATTTTCATTTGGAATGTATGAGTCCAGACTGACTTTTTCAGAATGGTTGCGAGATCCGAAGATACAAGAACTGTACCATCGAAAGCACGCATTGAGCAA
CCTGACTTCAGATGGAGAACATGTCGCTCGTCCTGAAAATGCTAATTAAGGAAACATGTTCCGACGTTTTCTTTTGCATTCGTATGAAGGCCAGACGACT
A