Description :
From Genome Similarity Track
Location :
Scaffold_3550:532- 1533
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3550-snap-gene-0.1Transmembrane amino acid transporter family protein

Sequence
1001 bases(100 bases per row)
CGTACGCGATGCTCGAAGGAGGCTTCGTCATGTGTATCTTTATGATCCTCTTCGTCGGGCTCGTGACGCACGCGACGAGGACGCGACTCATTGAGCTGGG
CGTCGAGCAGGGCATCTACTCATTCCAGGGGCTCGCCAAGCTTGCGTTTGGCGCGGTCGGTGGATACGCCGTTAGTGTGACGCAGCTGGGTCTCTCGCTT
GGCCTCGTTATCGGCTACCTCTTGATCGTCTTCCAGGACATTCCGATTGTGTTGGGGCATTGGTTCAAGATGGACTTCGACTCCAACGGACGACCCATTG
TGACGCCCAAGAAACGAGTGTCCCCGCTACTTCATTTGCTCGCTGACCGTTACTGGTTCCCGGAAGCCTTGGTAAGTTCTGTCTTTCCCTCTAATCTTAT
TGTTGTCTAGCGTGTGTATCATTGATATTGTGTTGATAGGTGATGCTCGTCGTGCTACCGTACTGTCTGTACGGCAACTCGTATGCACGGTTGCGTGTGT
CACCAGCGTTTGTGTGCACCACCGTCACCGCTGCGGCCTTCAGNNNNNNNNNNCGCACGGTTGCGTGTGTCACCAACGTTTGTGTGCAGCGCCGTCACCG
CTGCGGCCTTCAGTGCTGTCGTAAGGGCAAAGGCCGACCACAATGCCAATGTCACCACCCATTCGCAGGGTTACGATCGCGACTACCTCAAAGTGCCTCC
GACCGTTTGCCGAGCGTTTGCGATCCTCGCAACGTGCTTCGCGAGCCAGCACCACAGCTTCCATACGTTTTACGCCATGCGCGATCGGTGCCCCGTTAAG
TTCAAGCGCCTTTCGCTACTGGCAATGCTCTGGTCGTTTGTGCTTGCGTTGAGTATCGCCATTGGCGGCTACGTGTCGTTTCTCGGGGCGACAAAGGCGG
ACGTTCTCCACAACTACCACTTTAAGAGCAACCGCTTCGTGCTCGTTTTCTGGACGGCATTGCCCTGCAGTGCGATTGCTTGCATTGCATACGAGGTACG
A