Description :
From Genome Similarity Track
Location :
scaffold_75:53179- 54403
Sequence
1224 bases(100 bases per row)
TGCGTGCACCTAACCGGTCATACTTAAATCGCTGGCGGTGGCTTCTGCAGTTTCAGACCCCAGGGATGCTTGTACTTCATCCCTGGGGGCTCTTGGCGGC
TTTGTTGCGATCCCCCAGTCGCCTATTGGACGGTGTGACGGCTTCTCATCATCGCTACTTGGATCGAGCTGCAGCGGCAGTGACGCAAAACCCAGTGCTG
TTCCCGAATGGGTTTTTCTCCGATGGGTGGGGGGATTTAAACACGCCTGAACGACTTCGCGAACTGCTACAGAGTCGACGTATGAACGAAGTTGTGGCTC
TGCATGAGGGAGAACTCAATTGGGGACAAGTTCGAGAGCTATCAGTGGCCAAGGTTGCGTTAAGAGAGGGGAAGTTTAGAAGCACTTTGGGAAATGCACA
GAAGCTGCTGCCTGAAGAGAGTCTGGACGCGTTCTGTGAACTGGTTACGCCGCTAGAATGGGAGCAAGAGGATAAAGGCATTCCGCAAGGGAGAAAGGAT
CGGCCTCTTGTGGGTAAGTTAGATATGTTCTGACTGTGACAGTGAAGAGTTGGCGAATAATTGTGCCGTGTCACGTAGTGCTGCTACCGGGAACGGGAGA
GCACGGATTTCTGCATCGGAGGACATCCATTGCTATCCCACTGGCAAAGCAAGGGGTTGCCACACTGGTACGTTTGGTATACAGTCACCGACCGTAGTTT
TATTACTGCATTTCAGTCCTTGACAGTTGCATGCTGTCACTGTAGATTCTGGAAGGACCATTTTACGGGAAACGCAAACCGCCGCAGCAAAAAGGATCCA
AGTTGCGAAGGTATGTTGTGATAGACTTGTTTTGCTAGTAGAAGTAGAACTGAGTGGGTGTTTCTGTGCCATAGGGTAAGCGATCTGCCAATATTGGGTC
AAGCAACAATCGAGGAAGCCAAATCCCTGTTGGAACACTTTCGAGATCATCACGGTTTCTCTCAACTAGTGGTCGCAGGCAGTAGCATGGGTGGGCTCCA
TGCTGCTATGGTTGCTTCAGTGTTTCCTGGTGACGTTGGCGCTACTGCTTGGCTAGCTCCACCCTCGGCAGTCCCCGTATTTGCTGATGGATTGCTCTCC
GGATCCTGTAACTGGCGCTCACTTTACAAGCAGCACGAGCTTCAGATGTTGGATAAAATGCTGGCTGGACACGCCGTGGCTGAATCCTACGAAAAACTTA
CCGACGCTGTTGCTGACAGTGAGG