Description :
From Genome Similarity Track
Location :
scaffold_5:531754- 534085
Transcript NameFunction/comments
g8200.t1 conserved hypothetical protein
g8201.t1 hypothetical protein PHYSODRAFT_471024
g8202.t1hypothetical protein

Sequence
2331 bases(100 bases per row)
TTCGTAATTCTAGCGGCCGCAAAATGACGCACATCAAGAAACCCGTGATCTCCAAGCGCCCGACCATCCAAGGCATCTGGCAGCCGGACCTCGACTTCCC
GGAGTTCAAGATCAGCGACCGCACGTAGACGTCGATGCTACTGGTTTGGGAGAATGCAGTTTTCAGGGTCGTTAGCGTAGCTCATTAGCAGCAATGGAGT
TCACTGAACACTGCAACAGCACTGCACAGGCTATCTCAACAAGTGAAGCATCAAATATATTCCTTCAACAGCCGCCGAGAGAAGGGAAGAGAGGTCCACC
ACCTCGTCTTCCACCTCCCCTCTCTTATAACTCTTGGAACTACGAACTAGCAGGCGTGTTCACGCCGCTGCGGTAGCTCAAGCTCAAGCTCAAGCACCAG
TGGCGCCATCCAGCTTAGAAACCGTGCAGCACCACCTGGGCGTCCGTGCAGATCTCCTGGTCCAGCAGGAACTCGCGGATGTTGGTTCGCTGGTCGCCCG
ACAGCTGGATGATCTCGCCCAACTCGTCGTCCTTGACGATGGCGCCGTTGCAGCTGAAGTTCTTCTTGAAGGCCTTGAGGATGCGCTTCACGTCCAGGTC
GTCGGCCAGGCCCTGCACCGTCGTCAGACACTTGCGGCCGTTACGCTGCTGCACACGCACGTGAACCTTGCCACCGCCGATGCTCGAGTCGTCCTTGGCG
TCGGCAAAGGCGTCTAAAAAGAAGCAATCAAATCAGTACAACGCTCCGCATCTACCTGACTACTGTACACCTCCATATTCACCCTCCTACTTCCGCAATA
ACGCACCGAAGGTCTGGAAGTTCTGGATGTCGGCCATATTCGCTACGTGTACGGGACTTTTGTATTTGAGTGGCGCCCGTCGGATTCTCCCAAGTTCTGC
GCTATGATTGGTCGAAAACCTCGAATCACACCGCATTCACACAACTATGTGCCTCGCTCTCATTGGTGGATAATCATATTGAAGCGCGAAAGGGTGCGAT
CATCGCAGTGCATCTACTATTAACATGGGCAACGCGCTGCTGGTCGCGTCCGTCAAGGACCGCCAGGCGGTGGCACTGGCCGATGCCATCCTCCCCTTTG
ACAACCTGCGGCTGCGCGAGATCGAGGCGTTCTGGCGCGCGTTCTACGACTCGGCGACGAGCTTCGCGCTGTCCAGGAGCCAATTGCGCTCCATCTGCTG
CCGCGCAGTGGCCACAGGCGTCTCGAGTTTGCAGGGATCGAACTCTCGCATCGCCGAGTATGCTGACGCTGCCTTTGAACTATTTGCAGATCCTTTTATG
CAGAGAAGGTGGCAGCCAGGGGCTAGAGGGATGCACAGCCAGCAATTTTCAGCTTCCAGCGATAGTTTGGCGGCAATTGACGCCCTCGAATTCCTTTCGG
CTATTGCGTTCATTGCTGCAATTCCGCTGGATGAGAAGATCGATTTGCTGTTTGATTCGTGGGATATGTCGGAGGACGGAGCGCTGGACTTAGATGAGTT
CACGATCTCATTGAAGTCGACGCTGTCGGGACTGGTCAAGATCCTTCAGCCGGTTGGCCCTAATCTTGCAGTCAGAGCGGCGAACTCGGATACGGTGGTC
AATGAAGAGGAGATTGTGATGCTGGCTGAATCGACTTTCAGAGAGATCACTACCTGTGGAGTCTCGTTGTCGAAGGAGAAGTTGCCAGCGCAGGAGACTG
CCACAATCACGTGTGAGCAATTTCGGGAATTTTGTGCTAAGAACAAGCGGGCAAAGGAACTTTTCGACTTGTTTGATGTTGCAGATGCTAGCCCGGAGAA
ACGTGGGATAGAAGCTGGAGACCGGGAGGATTCAATGGAGAGTACTGAAATTACGCTAGTGGCCAAGCTTGAAAAGCACTCAGTGTCGTCGGACTCATCA
ATAGTCGTGGATACACCGATGGATGTTATGCTTGATGACGTCGGTGATATGTTTCTAGCAGTAAAGCCGTGGATAGGAGCAATTGTACCCCCAAGCAAGG
TCCCCCCGATTTCTAGAGGAGCCCCACTGATCTCAGTCCAGCTAGACTGGGTATTTGGATACAGCGCGCAAGACTGCAAAAACAACGTGCGCTTTGCTTC
AACAACGGCCGGTGGCAGAGCTGGACGCTCCGAAGAGATTGTATACCCAGCTGCAGCAACATGCGTTGTGCTCAACACAAAATCCATGACTCAGCGTCAC
CATCTAGCTCATACAGACGATGTGTTGAGTTTATGTCTGCATCCCCGCCTTCCCTTGGCTGCAAGTGGTGAAATCGGCAAGCAACCTAAGATTATTGTGT
GGGATTTAGACACAATGGAGACCCAATGCAT