Description :
From Genome Similarity Track
Location :
Scaffold_177:5317- 7554
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_177-snap-gene-0.16Protein kinase
Pytul_var.sporangiiferummaker-pug3_contig_177-snap-gene-0.17Gene of unknown function

Sequence
2237 bases(100 bases per row)
TGTAGCATCGCGACGACGTACGACGCACTCGGTCGGAGCGAGGGATCGTACTGCAGACACGCAGACGCGAGCTCTTTGACCATCGGCGGACACTCGTNNN
NNNNNNNNNNNNNNNNNNNNNNCGTGAACGGGAACATCGACATGAGACTCGTGCTGTTTGACTCGTCCACGGTGCTGTTCGTCGCCCGGTGCGAGCCTTC
CATGCCCAACACTATCGTCGTAGAGATCGGATTCGGCTCGATCATGCTGCGCATGCGCCACGAGTTGCGGATCATCTCATCGGCAGTCTGGCAAGTGTCC
AATTGCGCGAGCAGCACACCGAACGCAAACATGTCGGAAGACGACCTTGACGGTTCGCCAGCGAGGATCTCAGGCGCAAAATAGCCCCGAGACGACTCCC
CATACCGACGAGACGGCACGACGTCTTCGGCCACACTCGCAAGCAACGTGTTGAGTTTGCAGCCTTTTTCGCTGTCCACAAACACGCTCCGGCCATTGAG
ACCGTCGTAGGAGAGTTTGTGCTTTGAGTGCAAGTACATCAACCCTCCCGCGATGTCCATGGCTGCGCGCAGCTTGAAGTTGCCCCACGTGAGATCGTTG
CCGGATTGCATCAAGTAATCTTCCAGTGTCCCCTGATCCATGGCTTCGCACACGACGCTCACAGGGTGGAAATCTTCGCACATGAGCCCAATCACAGAGA
GCAACTGCGGATGGCGAAGCTGCGAGACCACAGGGACGACGTCCAGCACCATTTCGCAGTTCTCTGCGGCGTCTTCCTTGAGCTTGAGCTGCGTCACGTA
CACGAGCTTCTTATTGTATTTTGCCTTCTTGACGCTCACGACTCCGTTTGTCGTCACGACATTGAGCATTTGCAAATGTTCCGCAGGGATGTCCTTGAAC
GTGGTTTTGCGGAACGAGCCCTGATGATTGCCTTGGAGCGATTCCGTGAGATCGTTGGACATTCTCATGGTCGACGAAAACTTCTTTATCGCAAACTTAC
GCGCAGCAGCGGATTTCTCCTTCTTGTCGGCTGCATTGGTGGCGACCGGGTTGTCCGTTGCCTTTCGCTTGGCTCGTTTCAACAAGAAGATCCCGACGAT
TACGGCGGCAACGACAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCGAGCACGACCAGTAGAGTGCCCGTGTTGCTCTTGGAACCTACTGCTGTCG
ATGTCGTGCTCTGTTCTAATGACCCGGAGCCCAAGTAGTCACTCATGACATCGTCTCCGTAGCAAACCGTCTTGGAATCCCACGAGTACGATTGGTATCC
ATCCTGGCAGGCGCTGCTCAGCTTCATGGAGCCTTCAAAAGTTGAGAGGGACTTGAGAAATTCGAGCTGGCCCGTCGTGATATGCACGTCCTTGATGGCA
TTGCCCTGCAGGTACAGCTCCGTCAAATTGCGCATTTCGTACACGATCAGTGGGATCTCCGTCAGCCCATTCTCGCTCAAGTCTCTGTAGTGAGCATCAA
AGCAACTTCATTAGTTCATCTTTCGATGCAGATCAAGTAATGGCGAATGGCTGCAGTGTGTGGAGCTACTGACAAGATCTGCAGCGCGGAGAATGGCTGG
CTGCCTCGCGGATCGAACTGCTGCATGTTGGTTCGCTGGATAATTCTGATTATTTCCACACAAAAAAGACCTTGAGAATCCCCGTTTTCAAGCCAAAACA
TAGAATAAATCCCCACAAAGTTGTCTTACAGTGACTGTATGCTGGGAGGAAACATGTCTGTCGTGAGGCTGTCGATGGCGACGTCCACGATTTTGCTGCA
AACAGAACCAGATATTGTGAGTGAATCGTAATGACGGGACCACATCGCACGCTGAGATGAAGCACGTACATTCTTTCCAGCGACGTGCCACTCTCAAAGG
CGCCGGTCGCGAATGTGACTGGCACTTTCCGCGTCAGTTCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACGATGCTCCTGTTTCAAAGAACACAAT
TCCCATTTAGCCCTTTCCTCCATGTACACACAGTGGCTGTCAATCAAACCCAATTGTTGTGTGTGCTTACAGGTTCTTGAGCGTGGTCGGGAGCATGAGG
CTCTCCACGTACTGGAAGAGCGACGTCTCGGCTTTGTCTTTCTGGGGCTGCGCNNNNNNNNNNNNNNNNNGGCCCAAGTTGTTTGTCTGAAGGCACTGAA
TCTCACAATTTGCTGTCGACACGTTCGCCTTGCACGT