Description :
From Genome Similarity Track
Location :
Scaffold_137:53160- 54699
Transcript NameFunction/comments
Hyaar_Emoy2810788hypothetical protein

Sequence
1539 bases(100 bases per row)
GCAGGAAAAAGTGAGCGGAAAAGCTCTTTTTTGTGGTAGCTACTTGAAGCTGTTGTCGTTTTGACAGCGAGGGACATTGGAGGAAAGCGTGCTGGTCGTG
GATGCGGACGTAGATTGCGATGATAGCTACGACATGGATTCAAAGCGTGGAGAAGGAAGAGGAAGAGAAGAGGAATGTTGATCGGGTCAATGAAGCTTGC
TGCGAGATATGTTTTGCTACCAACTCGGTTTGTACATGTTGAAGTGGATCAGTTGGATCAGTATAGCTTCCTGTATGAAACAGATAGGAGGCGTTTTCTA
GTCGTTATGTGCCGACTTGTCTGTCCTTATGGTCGAGGTAGTGTTACTTTTATAACACGGTTTTGGGCCGGTAGCGGGGCAGCCAAATCACAGCAACGAG
TACTTGACAGGGCTAAGGCTTGCGCTGTTGCTGCTACTTCTACTGGCACGAGACAAACGCTATGATTCAGTAATCGTATCCTGCGACAAACGCTGTTGTG
AGCACAAGTTGCTTTTTCAAGTTTCACAAACGTCTGCGACTAAAGTACGGAGCTAACGGCAGCAACTGGAATGCTGATGGCAGCAGTCGCCGTTGCTTTC
CATCAGGATGTCCGTCCACTGGTCGTACAAGTTTGTGTAGCCATTGAGCCACTTCAAATTCAGGTCGGAAGAAACCTAAGCGATTGACTGAGACTGACTA
TCGCCGTACCAGCTGCCTCACGGGACCTACCCCTTGTAGAATGTTGGTTTGCACTTGCGCCAAATATGTCGCAACAATTGGGGGCGTGACCAGATCTGGG
AAAGGGCTGTATACGTGAACGTGCGATTTGCTGCCTCTCAGCCAATCTGCGACTGGCACGGCGTAATATCAGCTGCTGCGCATGTCGCAGAGGAGACCAA
CTAGCAGGTTACCCAGTGGAATACTGCATGTCAGCACGCCAATATAAAAAGCTGCTACAGCTGAAGTACCTTTTACGAACACTGACGCTTGCTTCGGAAA
GGTACACTGTAAACGCCTCCCTGATCGTCGACTCTTATGCTTCTGTCGACATAAGACTTTGCTCAATGCACGAACACTCAGAGCCCTGTGCTGCTTCTCG
CGTAACGGTAGGAACCATTGCAGCAGCATCAAGTGTGATCTTGTGAGAGGAGACAAAGTGCGCACGATTGCAACGCTTCCAGAAACTTCAACTACGCGGC
ATTTGTATACGTGTTATTTTTTCACATTGTCCGACTCTCGTGTGGATAAACACTGTGCAAATGCTTCATTCGAAAAAGTGGATACCAGGTCTCCAACTGA
GCTGGAGATGGCGTGGTCCTCTGACGTCAGTTTCAAGGCATCTAGTATACTGTAGTAGAAAGAGTCGTCGAAGTAGCTAAAGTAGCAAAAGTAGCAAAAG
TAGCAAAAGTAGTAGTAGTAGTAGTAGTATAGTAGAAAGAGTCGTCGTCGTCCTTTTTTCCCGTTCCAATCAGACCGACAAGTCGTGGGTCTACTCTTGA
ATACGCCCACCCTAGCCCTATCTCTTCAATGTCGATATT