Description :
From Genome Similarity Track
Location :
Scaffold_714:5316- 6362
Sequence
1046 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTTGTAGTCCATCCAAGGACCACAAAACCCGTTCAACATGAACATGTTGGACGACGAAGCCGACGACACCTTTCACGGAA
CCCGTGAAAGTCACTCCTATTTGAGTGGTGTCGAATGGAGTGCGGTCGAACAAATGAGTTCGACCGTTGGCGAAGAAGTTGTCTGGTCTCTGCTATCTTC
AAGGGATAAGGACCAGCAGCATTCCGTAATCGCCAAGGTCTTACAACGAGAACTTGACGCATCGCGAGCTGAAGTGACCCTGCTGCCTCAGCACGGTCAC
CAGCAGACTGAGCTCCTGAGACAGCAACAGTCTCAGTCTGCTACTGTAGCGTCGACACGTGAGCGTCGACGCGAGACTCTAAGTTAGAAGTCTCCAAGTA
CGGGGGAGTCGAGGAAGACTCCCTGTTGAGATTGCTCCTCGAATCGGACGATGCTATTAAGGCTTGATACATCGACGATGAGGAAATGCAAGTTGCATTT
GCCAAATCGAATTTGTCAGGGCGTGCCAGAATTTGGGCCCTGAATCTTCAATTACACGATCCAAAAGTGTTTGGATCGTTGGCGGTCTTTAAGACTCTGC
TCAGCTAAACGTTTGAGCCGCCAAGAGCTGAGCTCAGGACTCTTTCAGAGCTCCTGAAGATAAAACGAGGTAAGCTGACTTTCACGCTTACGCTCAGCAC
GTCCGTTACCTTGCAAGTTGCATGGTAGCGAACCCTGTAAGTGAATTCGTGTTGACCACGATATTCTTACAGGGCATTAGAGATGGTCCCGTGAGGAACC
ACCTCTTCCGCATCGAGTCGAAGTCGCTTGAGGAAGCTATTACAACTGCGGTGCAAGAGGACTTTAGTGTGAGACAGGCTCACACTAACTTGACCCCCTG
TCGTCCTTCGAGACGAGTAGAGGCGGAAGGTCCAAAACCAATGGACCTCTGCAGTTTCGAGAGTAAGAGACCTCGCTCTTCAAGCAGTAAGCGATTGCAA
AAGTGCAATCGCTGTCAGAAGTTAGGACACTGCACCCACGAGTGTA