Description :
From Genome Similarity Track
Location :
Scaffold_6:531453- 533935
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_02517myosinlike protein putative

Sequence
2482 bases(100 bases per row)
ATGGTTCCCGGGGCGCTCTGCTACGTGCCCGATGAGGTCGACGTATGGCTGCCGGCCGAGGTCGTCGGGCAGAAGGCGGGCACGAAGCAGATCACATGCA
AGGTCTGGACCGTCGATGGCCACGTCGAGGAGCGCGTCGTCGACCTCGAAGACAAGAAGACGCGCGCGCTCATGAGCGGCAAGGGCGAGGCCATGGAGAC
CGTCGACACGCTGCCGTTCCAGAACGAAAACGTCGGCGACGACGGAATTGAGGACATGATCACATTGAACTACCTCCATGAGGCCGCCATCTTGTACAAC
GTCAAGAAGCGCTTCTTGCGCGAGCTCCCATACACATACACGGGCACGATCTGCATTGCGGTCAACCCGTACAAGTGGCTGCCCGAGCTGTATGCGGAAG
AGCAGCACGTGCGGTACCTCAACATCCCACGCGAAGAGCTGCCGCCGCACGTGTACGCGACCTCGGTCGCGTCGTACGAAAACATGAAGACGCACAGCCG
CAACCAGTCGATCCTCGTCAGTGGCGAGTCGGGCGCTGGTAAGACGGAGACGACCAAGATTCTCATGAACCACCTCGCGACGATCGCCGGTGGCATGAAC
GATGGCACGATCAAGAAGATCATCCAAGTCTCACCGCTGCTCGAGTACTTTGGTAACGCCAAGACGGTCCGCAACGACAACAGTTCGCGCTTCGGCAAGT
TCACCCAGCTCCAGTTTGACCGCGCGGGCACGCTCGTCGGTGCCAAGTGTAAGACGTACCTCCTCGAGAAGACGCGTGTCATTGGCCACGAGTTTCCCGA
GCGCAACTACCACATTTTCTACCAGGTAGATGCTTGCACGATATGTATGCGAAGGACTCAGATTGTATGTTGTAGCTCATCGACTCGGGGGACATGGCCA
AGACGCTCTTCCTTGATCAGGACGCTACATACCGGTACATTGGCGAGAAGAGCACGGCGCTCATCGAAGGCAAGTCGGACGCACACCACTTTATGGTCAC
GGCCGAGCGCCTCAGCCTCATTGGCTACTCGGCGGCGGCGCAGCTCGACCTCTACAAGACGCTTGCTGGTATCTTGCACCTCGGCAACCTGCAGATCATC
TCGGACCCGTCCGATGACGAAAAGTCCATGATCGCGCCCGGCGATGTCTCGGCGACGTACATCACGCAGCTCATGGGCCTCACGATGGAGTCGCTCGAGA
AGGCGCTCTGCTCGCGTACGATGCGGGCGCGCAACGACGTGTACAGCGTGCCGCTCAAGAAGGTACTATCATCTCGATATCTTGGCGGCGGTATCTCATA
TTGCGACGCTAGAGCGATGCGGAAGCGTGTTTGGACGCGCTCGCCAAGGCCATCTACTCGCGCGTCTTTGACTGGCTCGTCGAGCTCATCAACTTGTCGC
TCTCGAACGATGCCAAGATGACCAACCACATTGGCGTGCTCGATATCTTTGGGTTCGAGCACTTCAAGTTCAACTCGTTTGAGCAGTTTTGCATCAACTA
CGCCAACGAGAAGCTGCAGCAAAAGTTCACGTCGGACGTGTTCAAGACGGTCCAGATCGAGTACGAGGAAGAGGGCATCCAGTGGGAACACATTGAGTTC
TCGGACAACCAAGACGTGCTCAACGTCATTGAAGACCGCATTGGTATCATCTCGCTCCTCAACGAAGAGCTCAAGAAGACCAAGGGCTCGGAGGCCGGCT
TCATGTCGACGATCTCGTCGATCAACAAGGATTTGTACAAGCCCAGCGTCATTGAGTTTCCACGTACGTCGCGCACCGAGTTTATCATCAAGCACTACGC
GGCGCCCGTCAAGTACGAGTCGCTCGGGTTTCTCGAGAAGCACAAGGATAACTTGCTCCCGGATCTCTCGGACCTCATGCGCGGCTCGGACACGACGTAC
ATCCAAAAGCTCTTTGAGGAAAAGGCCGTCGAGGAAAAGAAGGAAGAGGTGCCGGCCGGTCGCCGTCGCGGCGGCACGCTCAACATCTCGACCGTCGGGT
CGCAGTTCAAGGACAGCTTGACGGAGCTCATGACGACGATCCAGTCGACCAACGTGCAGTACGTGCGTTGCATCAAGCCCAATTCGATCAAGAGCGCGAC
GACGATGGAGAACGCGATGGTTGTCTCGCAGCTGCGGTGCGCCGGTGTCATTGAAGCCATTCGCATCTCGCGCGCCGCGTACCCGAACCGACAGACGCAC
GAGGAGTTCTTGGCCAAGTTCCGCCTCTTCGTCCCCGCGGGGCCGGGCAACCCGCGCGAAAAGTGCGAGCAGCTCATGACCAAGCTCAAGCTCACGTCGC
CGGCGCAGTACCAGATGGGCTGGACCAAGATCTACTTCCAGCTCGGCGTGCTCGAAGAGCTCGAGGACCGCCGCAAGAAGTTCCTCGACAAGAAGGCGCG
CTTCCTCCAGAAGATCATGAAGGGCTTCACGCAGCGCATCAAGTACCTGCGCCAGCTGCGCGCGATCGTCAAGCTGCAGTCG