Description :
From Genome Similarity Track
Location :
Scaffold_1508:5314- 7106
Transcript NameFunction/comments
Phyag_g10828hypothetical protein PHYSODRAFT_506357

Sequence
1792 bases(100 bases per row)
ATTCGACGACAACGGGGCAAACATTGTAGACGTCGccggtgctgccgctggaagaGGTGACGATGAGTGAACTGCTGTTCGACGAGTACGTGGGGCTCTG
CGCTGCGCAGACACAGGAGAATAGCACGAGGAGCAGAGTTGAGCACCACATGGGTCCAACGAGGCAAAATAAGTTGTGAGACGAATTCAATGCCTGCTCG
AGTAGCTACGCACTGATCGTTGGTAGCCGCTGCGCCATTAATCGCCTTGGCTCCCCATGTACGGACCATTGGCGACCCCGAGTGAGTAGCACCGATTCAC
GAGTTGAACTCCATCTTCCTTTGAAAGGTATCAGAAGATCGCAAATCTGACAGGCAGGCCTGGGCGCAAATCCGCATGTGTCAGGGTAGAAAAATTGTCT
AAGAAAAAGGGCCACCGTGGTCACCTATGCGCTTCGTCCGTGGTGGGACCTAGCTTGCGCGAGTTTTTGGGTCTCAAACATACACATCAACCCGCAGATA
TAATATGGGTCGTTGGCTGGCTGTATCAAACGAGTTATTGAACACCAATGCCTCGTTGGAGGGGGGTTGTGTTAGGGTGTACCGGCACAGTTGTGCTTTT
GGCGATTTGGAGAAGATGTAAGTGAAGATAACCACTCCGGTGTAGGAACTACAGAAATCGAGTTTCGCGAAAATTGTTGAAGCTTTATTTCTGAAGTTTT
CGACCAGATTGGCACGCGCCATTGGAACGAAAAATGGTCTGCGGGCAGCTCAAATCCGGATCGTGGACTCGAAATTGGGTGTTGCATGCCGATCCCATTA
GAGATCATATGCGTTCTCATTGGGTCGAGGCACGAGGGCACAATGGAGTCCATGGACTCGATTCCAACAATGAAGGAGAAGTTTCTTGGTCGGCATTTTC
CCGCGCTCCGAACGTCTTAGCACTGGTTGGGTATGGTGGAtcaccagacgcagcaagcTCATCGACACTGTCCGAGTCTTGCGAACCGCCTCTAGCAGGT
ACTTGAGTAGAGTCGGCTTTGCCCGTAACAATTTTAGCAGAACGACCATAGGCCTGGCTCGTTCTCAGTAAACATGTGCAGATGCGTCTACAATACTTTT
TTGAAGAAGGACAGAACTCCTTTGTTGGGCTAGTAAATTCTCCCACTATCATAGGGACATTTAGCTGCACTATAGGTACACAGGTAGTGGAGCGGTTAGA
TTGATAATTCCGAGCTTTGGGAACGCTTGCGAGGGGAGCATCTACAGTAGTGTTTAACCTCTTAAAAGAATTGGCAAAACAGGCGTAGGATAAATGGCCA
TACGTTTACAAACTTAAACACTTGAATCGAGTGATTAAGTTCGTAAACGTCGTAAATCCTCGTCGTTCGTTGACCAGCCGAATCTACTGCAGATAAGAGG
CGGTGTCCGCAAACGGCAGCACGTTTCTGTTTGGTCTCCTGCTTTGATAGTGAAATAATGCCCGCCCTTGGCCGCGCTTTCAAATTCTAATCGGCGCGTG
TAAGTGTAACCTCAAGTGCCAATCGCACCAGGAGACCATGGCAGACCAGTCGAGGCATGGTGCCTCCTTCCAATGAGGGTAGCGCACTACAATATATCGA
GACGAAAGCCAGACTGCAGGTGGCCATTGCGTACCTGAGTGTCTTCCCGATTAATTAGTTAATCCATCTTGATCACCGTTCTTGCTGCCTTCCTTCGCGT
CGAAAGTTCCGGTTGGAGCGGTGCGTGTGCAGGCAATGTCATGCGGCATGCGAAGTATACGGTGtagctgctcaagaactacAAGCACTGCA