Description :
From Genome Similarity Track
Location :
Scaffold_4:531230- 534439
Transcript NameFunction/comments
Sapdi_VS20SDRG_01886ATP-binding cassette, subfamily F, member 2
Sapdi_VS20SDRG_01887hypothetical protein

Sequence
3209 bases(100 bases per row)
GCCTCCAAGGGCGGCAAGGCCGCCAAGAAGGACGAGAAGGCCGAGTTCGTCCCCGCCGAGCGCACGCTGGCCGACAAGCTCGCGGACGATGGCATCATCG
CGACCTGCGCCATGAACGCCCGCTCGGTGCATGAGAACTTCAAGGACATCAACGTGCTCGACTTCTCGATCACGTACTTTGGCAAGGTGCTCATGGAGAG
CTGCGACATCTCGCTCAACTACGGCCGCCGATACGCGCTCATCGGCCGCAACGGCTCCGGCAAGTCGACCTTTATGAACGTGCTCGGCGCGCGTGGCATC
CCGATCCCCGACTCGATCGATATCTACCACCTCAAGCACGAGATTGAGCCGTCCGACATGACGGCGCTCGAGGCCGTCATCACGGTCGACGAAGAGCGTA
CCAAGATCCAGACCGAGGTCGACGAACTCTCGGAAAAGATGCTTGACGAGGGCCTCCCGGACGACCAGGCTGAGAAGATCACGAACCGCCTCACCGACTT
GTACGAGCGCTTGGACGAGATGGACGCCGACTCGGCCGAGATCCGCGCCCGCAACATCCTCCGCGGTCTTACGTTCTCGGACCAGATGATGCAGAAGAAG
ACGCGCGAGTTTTCCGGTGGGTGGCGCATGCGTATCGCACTCGCCCGTGCGCTCTTCATCCAGCCGACGCTTCTCCTCCTCGATGAGCCGACCAACCATC
TCGATATGGAGGCCGTCGTGTGGCTCGAGGACTACCTCTCCAAGTGGAAGAAGATTCTGCTGCTGATTTCGCACTCGCAAGAATTCATGAACGGCGTGTG
CACCAACATTATCGAGCTCACGCGCAAGAAGCTCGAGTACTACTCGGGTGACTACGACACGTACATCAAGACCAAGGAAGAGAAGGAAGAGAACCAGATG
AAGAAGTACGCCTGGGAGCAGGACCAGATCAAGCACATGAAGGACTACATTGCCCGCTTCGGTCACGGTTCCGCCAAGCTCGCCCGTCAGGCGCAGTCGA
AGGAGAAGACGCTCGCCAAGATGGTGCGCGAAGGCCTCACGGAGAAGGTCGTCAAGGAGATGGAAGGCGACTTCAAGTTCCCCAACCCCGAGCGCCTCCC
GCCGCCGGTGCTCATGTTCCAGGAGCTTGCCTTTGGCTACCCCGACTGCCCACTCCTCTACGAGGGTGTCGAGCTCGGCTTGGACATGGACTCGCGCGTC
GCCCTTGTCGGCGCCAACGGTTCGGGCAAGACGACGCTCCTCAACCTCATCACGGGCGACCTCACGCCGGTCAAGGGCAACATCCGCCCGCACTCGAAGC
TCCGTGTCGCTCGCTTCACGCAGCACTTCGTCGACGTCCTCGACATGACCAAGTCGCCGCTCGAGTACTTCCGTTCGCTCTTCCCGACCAAGAGCGTCGA
CGACGTCCGCTCGTACCTCGGCCGCTACGGCATCACGGGCGAAGTCCAGACGCAGATCATGGGCCAGCTCAGTGACGGCCAGAAGTCGCGCGTCGTGTTT
GCGTTCATTGCGCAGCAGAACGCGCACATGCTCCTCCTCGATGAGCCGACGAACCACTTGGATATGGAGTCGATCGATGCGCTCGCGCGTGCCATCAACG
CGTTCGAGGGCGGCATGCTCCTCGTGTCGCACGACATGCGTCTCATCTCGCAGGTCGCCAAGGAGATTTGGCTCGTCGAAGACAAGACTATCCGCGTCTA
CGAAGGCGAGATTTCCGACTTCAAGATGCGTGTCCGCAAGCAGCTCAAGCTCGACTAAATACTTTTTCACTCCTCTCTTCTTGAACTTAATAGACAACTC
TACTACTCGTTACTTCAGACCCTTTCGTAAGGTTATCGTGGTTTGTCTTAGGCTTCTTCTTGGTTGTTGTCCTCGGCCAGCATCGGCGCCGCTGCCTCCT
CGCTCGCCGACGCGATCACTGTGAGCTCCTTGGCATCGTCGCCTTCGTCGTCGGTCGACTCGTCGTCGTCCTCGTCCGACGGCGCGCGCGGCGGCAAGAG
CGCCGGCGCCGGTGTCGGCAGCAGCCGGACGGGACTACCGCCGGCCGAGCACGCGCTGCTGCTTCGACGCCGAAGGAAACCAGTCTTGTACTTGTGCGAC
TTGTTGAGAATCACGAGCTGGTGGCGGTCCACGAGGAGGCAGCCGCACTTGGCGCGCTATAGAGCGTCGGTACCCTACGAGCTGTATGGATCGGAGGAGT
GTATACCTTGCCGAGGCCGTGGTCCTTGGAGGTCGAGAAGACCGTGATGAGCCGCGCGGCTTTGCTCAGCGCCACGCCCTGCGTGCACGCTTCGTGGGCG
CGGACAACATGCGAATATTGATGGCGCGCCAAAAAGTCGTCGAGCGCCGTCGCGCCAAAGCAAATCGCACTGCCCCCCCGGGCGCTCTTGCCAAAGCCGT
GCTTGTCCAAGCATACCTCCTAGCCGTTCATGAGGTTCCATTTGCGACCTGGCGACCAACTTGTACCTGGTCGAGTGCGACGGGGTCGGCCCACATGAGG
TCTTCGGCCATTTGCAGCCACACGGACTTGGACTCGGCGCCTTTCCCGAGTACGTCAAACGACGCGAGACGAGGAATCTACACGAGGCGCATCAGTTGAG
GAGATGGGATTTCTCATACATTTTGAATCGAGTCGACTTGCCGCTCGTTCTCAATCGGGCCTAGTCAACGCATGAGCTGTTGGTCAGCAATGCTAAGACG
TACGGGGAATGCCGCCGTGGGCACAGAACACGTCGTCGTCGATGACGGCAGCGAGTGGCATGCGATCAAAGGCATTATTGACCTATCGCAATCGTCCTAG
CGCGCGTTGCTGCGCACGTGTGCACCTGGTGCCACACGATGCAGCCTTCGTCGTTCCCAAACCGCTTCTTGCATTGCGCGAGGAATGAGCCGATGCCGTA
GTGCTCTTCCCAGCCGTTCACGGCGCGCGTCTCGTGGTTGCCGCGCAGCATGACGACCTTGGTCGGGTGCATGATCTGGACAAGATATGTCCACATTAGC
AATGCTGCATCCGAGTGGTACCTTTTGCGCAAAGAGGTACGCGATGCACTCGAGCGACGAGAGACCGCGGTCGACATAGTCGCCGAGGAAGAGAAACGAC
CCGGCCGTCAAGCCCATCCCAAGGCGCCACAAGTTCTCCGAGAAGAATTTGAGGTCCGCGAGGTTGCCGTGGATGTCGCCAAACACATACACAGGACTCT
AGACATCCA