Description :
From Genome Similarity Track
Location :
Scaffold_1063:5311- 9351
Sequence
4040 bases(100 bases per row)
CATTGACGTCCAGGGACACGCACCTATCAAACAGCGGGCACGGAGACTACCTCTGCGTCATATCGGCAAGCTTTACGAATTGTTGGAGGGTCTGCTGAGA
GCCGGTCTGATTTCGTTCTCTGACAGTCCATGGGCATCGCCAATCGTGATTGTGCTGAAAAAGAACGGACAAGATATCCGACTTTGCATTGATTACAATA
TGGTGAAAGCGATCACAGCAATCATGGAATATGCCATGCCGCTAGGCTAGTTGACGATTTGTTGACGGATCTTGAGGGCTACCTGTGGTTTTGTTCTTTG
GACGCTGCGAGCTGTTTTTGGGCCGTTATGATGACCCTCCGAGCACGGAAGATATCTGCATTCGTGTGTGCATTGGGGCATTTCGAGTGGTTGCGCATGC
AGTTTGGGCTGAAGAATGCACCTATGATATACCAGCGTATGATTGACAACGCGCTGTGGGGCTTTATTGAGCCGAAAGGAGGCTGGGTGCATTTTGCAGA
ACTAATGCGAACGGCTGAAGACAAGGTTAGACGACTTCGCCAATGCAGCAACGAGGAATCAATTCAAACTGAGTTCGGGGTCGACCACGAAGCATCGGTG
GACACTGATCCTGTATTACAACTGGTCAATAGCTCTGCAGCGAACATGTTCATGGCTGGAGAGGCCGATGAATCGTCGCTGGTGCCTGATTTCGGTAGAC
GGTCGTTCGTGGATGATATTTGCTTCGGTGGCGAGACTTTCAGCACCTGTTTAGCCACTCTGGACCGATTGTTGGCACGGTTTGCTCAATGTCGGATCAG
CGTTAGTTTCACCAAAAGCGTATTTGTTCAACCGAAGGTTGGGTTCCTGTCTCATGAAATTTCCCAGACGGCATAAGAGCGGATACGAAGAAGCTTCACG
CTATCACCGAGTTTTCATTCCCATCGTCAAAACGTGGGATGCAATCGTTTCTTGGAGCACTGAACTACTATTGCCGATTCATTCAAGACTTCGCGGTCTA
TGGAGCAGCTTTGTACCAGCTCAAGGAAGCAGACTTTGAAACAGGAGGCAACCTCACAGTAGCCCGCTGCGCTACAGGAAAAGGTGGCAGAAGCTCCGAT
ACTAAAGCACTTCGATCGTTCCAGAAATGTTCACGTTATGCTGTTTGCGAACGAATGGGCATTGAGTACCACATTGATGCAAGAACATGATGGCAAGATG
TGCCCAGTTCGATTCCTCGATAGAGTGCTCGAGGACGCTGAAATGAATTATCATCCTGCGGAAAAGGAAGTTTTAGCTCTGTTGCTATTGCTGAAGACCT
GCTACACATAGCTGGCTGGATCAACACTACATGTCTATACTAGGTTCTCGACGCTGGAGTGGATACACAGGTCAAAATCGCTGTTTGGACGGTCAGTCCA
ATTTGCGGTATTACTATCGCCGTGGCATCTTATCGTCAAGGGAGTGAAGGAGACAGACGTGGCATTTGCACAGCTACTCCAGGCTAGCATAGCGAATTTT
ATTGACCTGGAGAAATCACTTGCGCCGTTAACACCACCAACAAAAGGCTCTCCGACAATTCGAATGGACCCCTTACTGATGGATCAGCGAAAACAGAGAA
GTATGGCGGTTATGGAAGTTGCTCGTGGGTATTGTGGAAGTTACCGGAGTGGAAAATAGTGATCACTGCGAACGCTTACCTTTCGTCTACCACTGAAAAC
CTCGCCGAGTATACAGGGATGAATAATGGTGTCAAAGCGGCTATTGAGTATGGCGCCGCTGATTTAGTCCTTGTGGGTGACTCTAGGCTCGCGATCCAAC
AATCTCTAGGGGTGATCGCATGTCGGAAGGAGTCTCTCGTGACATTGCTGAATCTTTATAAAACACTTACTTCGAAGCTTCAGTCAGTGAAATACCTGCA
CGTGGTGAGAGAATATaatgcagctgcagactcACTAGCCACTGAGGCTTTGGAGTCCAAAATGAGCCGGGTAGTCTTCGCCGAATCTCGGAAGGATGAC
TTTGAACCGCATCCAGGAAGTAATCTACGAACCGATGGAAGACCAGGCGGAGGTGGAATCACGTGATCATATGCATTCCATTGCAACTATGGCCGGTAAC
GAGTTCTCACAGCGGAAAACCTTTGAGAATTTCGTGCGAAGAGACACTTCAGTCGACCACGGAGAAATGACTGTATTGACTCGAAGGCAGGCAAAAGCCA
GGAAGCGCGTCAGGTTTGCCGATGAACACTCGCTGCACCACCCAGGAGCAAAAAAAACCAGAGGAGAATGGGCGGAAACACCCAGCGAGGGTTCACCAGA
CAGTAATACTTCACATCATCTCAACAATACGGTGTCACCAGCAGTTTCGGACGCAACAGATGTCGACCCGATGAAGATTCAACGTGAGCGAAGAAAACGG
ATTGCCCGGgcacaagatgaagagctgaAGTAGGCAAACCTTAAAACGGTGTTGACAGGTAACGCAGAGAATCTGCGCTACCGAGAAGCCCGAGATGCAT
GGAAGTACGCGGATCGATTCGTTTTATCTGAGGATGGTGTGCTCCACTACNCGACTAGTGGTACCGACAACGATGATTCAAGAGGTCTTACAGAACTGTC
ATGATTCGCTGGAAGGTGGTCATCAAGGCGTGGTACGGATATTTCAGCGTGTTAGGTCCGACTACTATTGGGCTGGGTTGTACGCCGATGTGGAGAAACA
CGTGAAGTCCTGCCCAGACTGCAGTTCGAGCAAAAGCAAGCCGCAGCTACGGAGTTACTCACCCGGCAATGTGTTAGCCGAGCGTCCGTTCCAGATTGTT
TCGATGGATTTTGTAATACCACTGCCAAAGACTCGCAGGGGCAACACtgcgttgttgttgtttcAGTGCTCGTTCACGGGCTTCACCATTGCCAAAGCAA
TGTCAGACACCTCGGCCCTCAGCGTAGCTCGAGTGTTTGAAGAGTGCGTCTACCGAAGGTTTGGAGCGCCGTCGTTGATCAGACACGATCGATACCCACG
CTTCATGAGTGAAGTTTTTCAAGCCTTCACAGAAATGATGCAGTGGAGATCTCGGGCAACATTGAGCTATCGCCCACAAGCTAATGGACAGCAAGAACGG
TCGGTGAAAACGGTGATGACTTCAGTACGTGTATACGCGGAGGACCCTCTACACCAAGACTGGGATGAGATTGCTGAAAGGTTGGTGTTCGCCATCAATA
CCTCTCAAGACACGACGCGAAAAGAGACACCGTTTTACCTCGTTCATGGGTGGGATGCACGATCTACACTCAAGGCTATGTCGTCTTCCCTCCGACAGGG
ACTCGGAAGACAGTCTGATGCGTTGACGTGGAGGCGCGAAGTCAATCGGCAACAAGAAATTTCACTGACTATGGCTAAGGAGTATCAAGCGTCGGAAAAA
GCTCGACGTGTCAAAGCGCACAATGATGCTCTAGGCCGACTAGAGGAAGCTTCGGTGCCACGCCCAAGTTCGAACGAAACGTCGGTATGCGGCCCAGAGG
CTTCAGCAGACCCATACGATGATGCCGACGGGCTAGCGAAGTCTCTTTTCAAAGTTGGGAGCAGGGTCTGGCTATAcatggagcgcgtcaagCCAGGGCT
AACGAAGAGGTTGGCTCATCGCTGGCATGGTCCTTTTAGGATTAAGCGCAAGATCGAAGATTTCGCATACGAGCTGGATCTTCCCGATCGCAGTGGATAT
CGCTTCTATCCCGTGGTTCACGTGTCTAGACTCAAGGCAGTCAATGAATTTCCCAGCCGTCCAAGAACTCAGTTGGTGCAGGATACGACCGAGGATTCGC
GCCTGGACTTCGATGAAGAATTGCTTCCAGAAGATAGCTGGGAACCAGATCATCTGGTAGGCGAATATGAGGTATAAGCGATCCTCGACGACTGCACTCC
ATTGTTAACACGCACTAAGCGTTCGGTACGAGAATTCAAGGTCAAATGGGTCGGCTATGACGAGCCAACATGGGAACCGGCGGCCAACTTGTCTTGTGGC
GGCCTCCTATACGACTATCTGCGAGCAAGGAAGAGTGACC