Description :
From Genome Similarity Track
Location :
Scaffold_971:5311- 6831
Transcript NameFunction/comments
Phyag_g8921tRNA uridine 5-carboxymethylaminomethyl modification enzyme gidA

Sequence
1520 bases(100 bases per row)
ACAGCGTCGCCGAGCGGATACCAGCGATGCGACTGGCTGCATGGATTGTTGCAGGTTGTGCTCGCTGCAAtttctcgcgctcctcgtTCGAGATCATTGG
CAGTTCAGAGTAGTCCACCCACTCCGGAATCTGTACGTGTTGTTTATTGCGGAAGACTCGGATCTCCTGGTGCTGGGCACGAAGTTGCGTCGCGTATAGA
CATTCGGTCTTCATAAGCTCCTTGACGTCGTCGGGCAACGCGTCTGCATGTTCGTAGCCGACTTCACGCCAGATACGCTCGATGTCGTGCGGTGTCACAG
TCGAGAACGCCAGAATCTGAGCAGCACTTCGCTTTACTCCGTCCAAACCCACCTTGACACCGTAGCGGTTCCACTCGTGAGGGTCGCGCAcaaactcgtc
cagcgccttgcgaGCATACTCTATTGCCTTCTCCTTGtgctcgagcttctccaccCGCTCACTCGGGATGCCAGCACCGTGCTCAAACGCCTTGCGAGTG
AGTCGCAAGTCAGCGTTATCTGCGCGAAGCAGAAGGCGGAACTCCGATCGTGACGTGAACATTCGGTACGGCTCCGTCGTGCCCAACGAGATCAAATCGT
CGATAAGCACGCCAGTGAAGGCATCAGCGCGATCGAGGACGAGGGGTTCTAGTCCCATGACGCTTAATCCAGCATTCATGCCAGCGATGATACCctgtgc
tgcagcttcttcgtaCCCGGTCGTGCCGTTAATCTGACCTGCCAAATACAATCCaggcagcttcttcgtttCGAGTGTTGGGTGCAGCGATCGCGGGTCC
ACGTAGTCGTACTCAACAGAGTATCCAGCACGCACAATCTCCACATTCTCGAGCCCCTTGATAGTACGCAACAACTCGAGCTGTAGATTTTCAGGCAGCG
CAGTACTAATGCCATtcgggtacacaaggtgtGTGTTCAAACCTTCCGGTTCAAGCCACAGTTGATGTCTAGAACGGTCAGCGAAACGAATAACCTTGGT
GTCGATTGACGGGCAGTAACGCGGGCCGACGCCCTCGCCATCTCTACCTCCGTCGTACTGCGGAAGCATGTGCAAATTGTCACGCACAATACGGTGGCTT
TCTTCGTTGGTGTAAGTGGCGTGACACACCACCTGCTTATCTGCGAGCGGCACCGTCTTGTGCTCGTTCAGGAACGAAAACGGCTTGGGAGGATCATCAC
TCGGCTGAATTTCAAGACCTGTGTAGTCGATAGTGCGTGCGTCAAGTCGAGGCGGAGTTCCAGTTTTTAGTCGGCCAAGCGGGAACTCGCAGCGCTCCAA
TGTCTGTGCAAGCCCCACCGCCGGTGGTTCCAGTCCGTCCGAGTCACGCATGTGTCGTCCCGCTGGAATCCGAATATCGGGTCCCTGGTAGATCATCCCA
CGGAGAAACGTTCCTGCCGTAATAACCACCTTGGACGCCAGAATCTCGCGACCAGAGGACGTCACCACTCCCTTCACTcgctcctccacctcgtccccAC
TCTGActcagcttctccagc