Description :
From Genome Similarity Track
Location :
Scaffold_1487:531- 2976
Sequence
2445 bases(100 bases per row)
TACGGCTTGAGTAAGCCAACGTAGAAGACTGGATGCGTGCGCATCTTCTTCGGAAGGTTAAGCGTATACGCTAGGCCCTTCTTGGCCACGACCTTTGAAC
GGTCCTATGAACCGTGGTCTCAATTTTGTCTTAAGACTGCAGACACTGCATGAGTAGGTAGGTTTTTTGCATTTAATAAAACTTGGTCCCCGACCTCAAA
CCTTTCTTCATTGCGTCTGCCTTTGGCATCTGCATGTTCTTTTTGCATATCTTGGCTTTCAGCCATAGCGTCGCGTACTTGACGCATTACGCTTAGTCTC
AAAGAGACAAAGTCATTGACTTGCTTGCGAACCGCAACAGGGCTGACATCAGCTAGCCGCTCGGCTATCCCTCCCCCATCAAGCCCTGAGCCACTGCGTG
GCGGCGTCAGTGGGACGCGAGGGTTAACCAAGCCGTTCACATAGAACGGAGTGTAGCCTGTCGAGGCGTGCACTGCATTATTTAATGCGAACTCGACGAG
TGGGAGCATCTGGCTCCAGCGTTTTGGCGCCTCAGCGCATACGCTTCGGAGGATATCCTCCACAACGCGATTCACGCGTTCTGTTTGACCATCGGTCTGC
GGATGGTCCGCTGTGGACATGTCCAAACGAGTGCCAAGCACTCTGAAGAGGGACGTCCAGAACTTCGCGGTGAAGCGCGGGTCTCGATCCGAGACAATTG
CCTCAGGCAAGCCATGTTGGCGAAAGACTCGGTCTAAAAACAGCAAAGCTGTACCTTCACCATCTATGGTGTCCGGCACCGCCGCTAAATGAGCCATCTT
GCTCAATCGGTCTACAAAGACCACAATACCCGTGTTTCCTGCCTTGTCCTTGGGAAGGCCAAACACAAAGTCCATACTCATGGACTGCCAACATCCCTTG
GGGACGGGCAAACTCGCCAATGGCGCTGCCGTGCTCGGCGCGGACTTCGTCCGTTGACACGTCTCACACGTGCGTACATAGGTGCCAACCCACTTATACA
TCTTGGGCCACCAGTACATCGAGCTCACCGAGCCATAGGTCTTCTCCCGACCTAAGTGCCCGCCCACGGGCGTATCATGAACCTCATAGAGGATTCGATA
CTTTAGATCCTCATCATGAGGAACGACTACACGAGGGTTATCCTCAGAGTCGGTGCTGTAGTACAGCAGGCCCGCCATCGAGCGAGTATCGATGCAGCCC
TCGCGCGTAAGCGCCCAGACAATTCCTTGTCAGAGTCTTTAAACTCTTCGCTCCCAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCTTGTGCATACGC
TCCGCGTATCAAGTCAGTCACAGACGCCTTCACTGTCGTGACATGAACTAACTCGTAGTCCGGCCTGCCCGAGAGCGCATCGGCCACTCCATTAAGCCAC
ACCGGCTTGTTCTTCACCTCGAAGTTATACTCGGCAAAGAAGGAAAGCCATCTTGCCCTTCTCTGAGAGTGATGAGACGACTGTGTCGCAGTGCGTAACG
ACGCATGATCAGTAAAGATCACAAAAGGCTTAGAGCCTAGCAGGTGTACCCTGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCTTTGTCATGAAC
GGAAAGCGAATGTTTCTTCTCTGCAGCTTTGAAGTTGGGGAGAATCCAAAGGGGAATCACGGCTTTCAGGCCCTCTTCGGGGTCGGTCTGTTAATAAAAG
CCACACACGAATGTCCAAATCCGGGAGGCGTTCACAGAAGCAGCTTAAAGGGACTGTCCGGGTCCGCGTAACGCCAGGAATCGTAGCCTCGGAAAAGCCT
CCTTTCACAGCCTCCAAAGGCTCCGTCGTGCTCGACGTTCCAGCACCATGTGCATCCTTCTAAAGAGATCTGATAATGCCCGAGCCATCTCCGCGTAATT
CGCGCTGTACTTGTGCAAGTAATTGGCTAAGCCTAGCCACTTGCGTAAGTCTTTTTGGTTCTTGGGAGCCGGCCAGTCCACGATGGCCTTGACTTTGGCA
GGATCTGCCCGTAAGCCACGCTTTCCCAATGAAGCACCCGAGGAAAGGTATCTCCTCCGCGCCAAAGACGCACTTGTCAAAGTTGGCATACAACTTATTA
GTGCGCATGCACTCGAGCACCGCTCGCAAATAGTCAATGTGGTTCTCCACGTTTGACCTTCCGTGCTCAGCACGACTATGGACGAATATATCGTCACAAT
ACGTCTGAGCGTACGCCCGGTGGGGCCTAAACAACTGCGTCACAAGGCGATTGAACCTTGCTGGTGCGTTCGACAGCCCCTAAGGAAATGACCAGCCACT
CCCAGAGCATACCGCTCGGAGTACTCACAACTGTCAGCGGAATGTCGCTCGCTCTCATGAGAAATTGGTAGTATCCATCGACCAAGTCGAGTGCACTGTA
CAACGTACAGCCCACCATGTTGCTCTGCAGAACATCCTTTCGAGG