Description :
From Genome Similarity Track
Location :
scaffold_41:53096- 55128
Transcript NameFunction/comments
g1824.t1hypothetical protein

Sequence
2032 bases(100 bases per row)
CGCGACGGGATTTGTGGTGGACGCGGAAAAGGGAATCATTCTGACGAACCGCCACGTCGTGGGACCTGGTCCGATTGTACGGTGGATGACAACAATGTTT
TGGTTGCTACGGTGACGGCTATTGACGGGATGTTGGTGTTTATATGTGCAGGATGCAGAGGCCGTTTTCCAGAATAACGAAGAAGTCCGTGTGATCCCCA
TTTATCGCGATCCGGTTCATGATTTTGGGTTCTTCCAATTCAACCCGGCGGTGAGCTTGTGCCTGTGTAAATTTGTTGGGGGCATTTTACTGATAGCTTT
TGGTAACAGGATGTGAAGCACATGTCAGTGCCATCACTGCATCTGGAGCCGGAGAAGGCCACCGTTGGAACGGACATTCGTGTTGTGGGTAACGATGCTG
CAGAAAAACTTGCAATTGCTAGTGGCACGCTGGCGCGTTTGGACCGTGATGCCCCCAACTACGGGTACAACAGTTACAACGACTTCAACACGTTTTACTA
CCAGGCATCTTCAGGAACGACCGGAGGCTCTTCAGGTTCGCCGGTGCTCAACCATGATGGCGATGCGATCGCTCTCAATGCCGGTGGCAAGATCGGCACG
TCAGCGTCGTTTTATCTCCCCTTAGACCGAGTTAAGCGTGCATTCGACTTAATCCGAGAAGGCAAGGACGTGCCGCGCGGCACTATCCAGACGATCTTCA
ATTACAAGCCGTTCGACGAGGTCCGACGACTGGGGGTAGACCCTGCCACTGAAAGGCTCGTTCGCTCCTCTTTTCCACTGGAAACAGGTATGCTGACGGT
GGCTGAAACGATCCCTAGTGGTCCATCAAGCAGCAAGCTTCAGCCAGGTGATGTGCTGGTGCGAGTTAACGGCGAGCTGATCACGCGGTTTGTTCCGCTA
GAAGCTATTCTGGACGACAACGTCGGGAGTGAGGTAAGAATTTCTGTTATATGCAAATGCTCTAGGATACGTGGCTGACAAGTTATTGTTTTTTTCTTTT
TACGATCCTGTCTTAGATCGAGCTTCAAATCGAACGCTCAGGGGAGCTAGTAACTCACAAGGTGCCGGTGCAAGACTTGCACTCGGTCACTCCATCACGC
TTTGTTGAGATTGGAGGTGCTGTGATCAACCCGCTGTCGTACCAGCAAGCACGCAACCATGCGATGAGTCCAGGAGCGCCTTATGTTGCTGATCCAGGCT
ATTTCCTTCAACGTTCACGCATTGGCCGTGGTGCAATCATCCACTCGGTCAATGGTATTAAGACGCCTGACCTCGAGACCCTCAAGAACTACCTGAAGCA
GTGCAAGGACCGTGACCGTATTGTGGTCAAATTCTCGAAGTTGACGGATAAGTCGGAAAAGGTTGAAGTTGTTCATGTGGACCGTAGGTGGTTCCCATTC
TGCGAGTACGTGCGCGATGACAAGCTCGGGACGTGGCACTGCGAGCATTTTACCCCGCCTAGTGCAAGCAGTAACACTGATGAAGACAAGGTCAAGGGAT
CAGTTCAAGATGAGCCGATTGGCTCAACAACAACTCTGCCTGGAAAGAATCCCGTGGAGAACAAACTTGCCCGGTCGTTGGTGACTGTGGACTTTGACAG
ACCGTTCAGCGTGAATAGTTTGTCAACATCGAACTACCGGGGTACTGGGCTTGTGATCGATGCGGCAAAGGGGCTTGTGGTAGTCGATCGCAACACCGTG
ACAGACTCGATGGGTGATGCCATGGTGACTTTCGCGAGCACCATCATGGTCCCCGCTCATGTGGTATTTGTCCATCCTGTACATAACTTCGCGATTGTGC
AATATGACCCGAAGCTCATTGGGTCCACGCCCATTGAAAGCTGCCAAGTGGCCTCAAAGCCGTTGACACCCTCCGATCCAGTATGGCTCGTTGGACTGAT
GAGTAGCGTGGGACGCAGTGGTCACTCCGATCTTGTGTCGCGCGAGACAATTGTGTCCGGTGTCAAATGGATCGGCTTGCCCATGCCCAACCCGCCTCGG
TATCAGGAACATAATCTGGAAATGGTCTCTCT