Description :
From Genome Similarity Track
Location :
Scaffold_1484:5308- 9088
Transcript NameFunction/comments
Phyta_totarag13097hypothetical protein
Phyta_totarag13098hypothetical protein

Sequence
3780 bases(100 bases per row)
GctcaccagcaactcgctcaagaTTGGGACATCAATATCGGAAACTCGCAGGCGACCTAAAGCATCCTGATCCCAAGGCACGACATCTGATGCTCGGTAG
AGACGCTGTATGTTGCTGGGAATCCACTCTGATCTCGGGACGGTCGTGACGGNAAGCTGGCACGACGACCCTCAGATCGAGAGCGAGAGAGTTCCATCAA
CAGCTCAGTATCGTCCTCGCCCAGACTGCTATCATCTTCGGAACGCTCTTCGACCTGACCTTTCACTCTCGGCCTGACGTTCTGCAGACGTGGGAGTTTC
ACCCGTGTCTGCGATCTCGCCCGGTGTTGAAATTTCGACGTCACCAGACGCGAGATCGACATCATGCTCCAGGTCCGCAGTTGGAGGGCAAGTCGAAAGG
AGGCGTTCCTCGAGATTGCGCTGGTGATCGAGATCTgaccgaagacgaagattgCGAGCAAGTTGTCGACAGGGAGCGTGGCCTTGAACGAGTAGGAGCC
GCACCGGAGACGAAGATCTCGATTTAGAGCGAGCCACCACAGGGATCACGAGCGAGTCAATGATAAGAcacgtggacgtgtcgcAGATGTAGATCGCAAA
TGcgcagccgaagaagagggcGAGGGCGGTGACATCCGACGGATCTTACGCGCTCGATCTGAGATGGCCTCATCATCGGACTTGCGCTGACCGAGAGTGG
TTGGCGAGGGCGCCGAAAGAGACTACCCCATGGCGGACACAACGGCGGAAAATCGCATGTGGACGTCTGTGTAGTgatcgtggagaagatcatggcCACG
GCGCAAGTCGTCACGATCTTGACGAAGGTTTTCGATCTCTTGATGACGAGAAGCGAGGGCTTCCTGCGATCTGGCATATGCCCGATTGAGCCGCGGAGGC
CTCTAATGACTTCtccgactgcagcagcgctaccGCGCGGCATTATGATCTCGAAGGGCATCGGATAACGCTTGATCTTGAGTCTACAGACGACGCGCGA
GaccaggagatggaggcgaACCAAGATCGGGATGCGAGGTCATGGCAGATAGTTGAGCCTCCAGGTTCGTGGTCAAGATCTCAAGTACTGACACGCGGCG
CCGAAGATGACGGATAGTCGAGACGGAAGCTGCTTGAGACTTGATGTGAGCCTTGTTGGAGGCAAGGGCCGACTCGATCGCTccctccagctgctccacg
gcAAAGTTGCGCTCCTCAAGTTGGGAACGCGCCGTTTGGAGCGCGCTGAGCAGCGAATTGTGCCGATACTGGCAGCAGTGGACGAACGAgacagcggcgg
cggcggcggagtCGATGTGCCGGTTGAGATCGCCAGCGCGCTGAAACGACGAAACGTGTACACGCTGAAGATCGACATGTTCCTcttgcaactgctgcaa
ctcggGTTCTCGACGCACAGCggtctcgatctcctgcaaAGTGGCCAAAACGCCTTGAAGCGAGCCATATACAACGGAAGGGCTGGCAGGAGACCGATCG
AGGCGCACTGTCGGAGCCGACACGTGGAGAGCGCACTCAGGACACGATGGCGTGGCAGCCGAGGAGCGAcgatcttcagcatcagcagcatcggcagctg
cagaagcagctgcgaTCAACAGGTGGAAGTTGGCCAGCGACGGAGGCAACTCAGTAGCCAGATCAGGAGCGGCATGCACGGAACCAAGATCGATGGCGGG
AGCTGGGTCGAGGTCGATCGTGGACGCCGACGTGGTCGCAGACACAGCagacggagatcgaggcACGTCATtcgcagctggtgcagcaccatCCGCAGGC
GCGGTCACACACCCAAGGTCCAGATCGATTCTggcctccgagtcgcgatctcgaactATCGATCGTAGACTCGATCCCCCAACGGCACAGCGTGAAGGAC
TTTccgcgctgccgtcacaagttcccgctgcccGGCCAAggcagtccaagatcgacactagtacttcctccgagatcacccgaagagcgacccagcccta
ccgacgggtacacaaggtgagcaaggtttttggcatccaacggatatcggagtaccccttccgttagtcggtggttcgggcgccgtgtgtcAGAGGGCCC
TGCGActagcaattttcgcagacccactacaccgCAGGTGCGTTAATTCAGTATGGCGGAGGTATGGGCGTCCGCGTCACGGAAACCTTACTCCCGGTGT
CATCAGTGTTGGTCAACCAAGTCGATGTCGTTATGTCGGAGTCGGGTCATACCAGCACTCGGAGTGATCGCCGATCGAGGACATCTCATAGGCGCACTCA
ATCCAGGAGATCGGGACGAAGTGAGCGGCCAAGCGAAGTGAGTTCGGGTGAGGAAAATCGACGGAGTTCCATACACCACGGTCACTCTCCCAGCCGATCT
TCCAAGCAGAAGCGGTCGCCGGGTCAATCGATCAAGTCAGAGCGAACTGGATTCTCCGGAAGGTCTAGCCGATCCGGGATGTCCAACGCTTCACAGGTTG
CCTTGAATACGATGAGGTCATCGCAGGAGGCGTTACCCTGAATGGAGTTAAAGCAAGATGCCGCCGACGCCCGCCAGGCCATGCAGGACGAGCATATGCG
GCAGTCTTTTAGGCGATCCAGACATTGGCTGCCCAAGCTGCTTAGCAGGAAGAATGTATCGTACGAGGTCTGGAGGTTCGTGCGAGCGCGAATGTACCCC
CTACGGTGCCCCCTGTTCAGACTCCCGTTGTTCAGCGACACATGTCGCCGGAAGATATCGAGGCTGCGCGAACAGAAGCGGCAAGGCAAGCACAGATTGA
CGCACAGAAGGTGTTCgagcagcgctggcaacagcttcaagctggtgccgacgaggagaaggcgagcTGGATCTCCAATCTACAGCAGAGCCTGAATGCA
CAAATGGAAGCTTTTCAGCAGAAGATTCAGACTCTGGAAGAATCTCGCAGTCGCGACCAAGCGACCATCCGGAATCTACGGAACGTTCGAGGAACTCACT
CGCATAACATTCCTGCAACACCACCCCCGGTTCAAGGCACTCAAGCAACACCCAGACTTGATTTGGCAACTCAACTCAGATCAAACCCCGATCATGCAAC
TTTACGTTCAGAACCCAGTGGCGTAATCATGGGAAAGGCGGACGAGAGGCAGAACAAGCCAGTTTCCCGGATAGTCAGTGATCTTCCTGCAGCCCAGCTT
CAAGTGACCCTCCAAGGTTTGACTGGGGCTAAGTATGTgaaggaagaagcagtcgtTAAAGAAGAGCCATCGTCCAGGACGCCCGAGTCGAGTGTACCCC
GAGCATCTTCTCGGAAGCCAACATCGAGGTCGAGTGATCCGTCGAAGGCTGAGGACAAGAAACCGGCCCGTAAAAGCTCTTACAAGAAGCATTCGTGCAG
ACACGGAAACCGCGCAGACCCTGGTTCCGATCCGGAGTCTAGTGATGGCAGCTCAAGTAGCGGGGACTCCGACAGCTCGTCCGACGATGTCCCGACGAAT
CCGGCAGCGGCCACTACCACGCAAGGAGGTACCACAGCGGTGACCTTCAGGCCGTATGTGAACTCCAGCACGTTGGAAGACTTCAATGGGAAAGCCCCCT
CGCTGCGCGTCGCCGCTGATGGGAGCGCTACCTGAATATGACCGTTCAAGGTGGCTGGACCAACCAGATGAAAGTATACGAGCTCAAAATCAAGGTGTTG
TAAGCAGTGCGTAACTGGCGAGGCCAACTTGCAAGGGATGTCAGCCGAGACTGGACTCTATTATCCAAGTCGTTTACTGC