Description :
From Genome Similarity Track
Location :
Scaffold_972:5308- 7621
Sequence
2313 bases(100 bases per row)
TCTAGCAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTGGCTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACATGGACTGCCAACACTCCCGTGGAGTTGGTAGTGGCTGCAAGGGAGCC
TGCGCGAAAGGCGCAGACTTCACACGTTGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATTTGTACTGGTGGGCCCAGTAGAAGTCTCGCGTGA
GAAGAAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGATACTCGTACATGATCCTGAGTCGCAGGTCATGGTCATTGGGCACGAC
AACGCGGTCCGCGTTGTCGTCGACTGCATTGTAGAGTAATAACCCGTCGTGCACCCGATAACGGTGTGCACGAGCACGAAGATGCTTCGGCAACTTCTGA
CGAGCTTTGTCAGAAGGCGCTGAGCCGTAGGCAAGCAAGAGCTTCGCGTCCACGTCGTGCGCGTACGCGACCTTCACGTCGTCCAACAGTGACGACGTTG
GGGTGCTCGATCGCATGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGCGTAGTCAGGTCGACGCGAGAGCGCGTCGGCCACCACATTGAGTCTTCC
GGGTTTGTACTCAACCCGGAAGTTATACTCTGCGAAGAAGGAGAGCCATCTCGCCATCCGTTGCGAGATGTGCGGCGACTTCACAGCCGTCCGCAACGAC
GCGTGGTCCATATAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCTCGAGTGCGTACTTCATGGCAAGGAGCTCCTTGTCATGTACCG
GGTGGTTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAGACGACACGATCACGACCCTCGTGATCGTGCTGCATCAACGCACATCCGATTGCGAA
GTCGGATGCGTCG