Description :
From Genome Similarity Track
Location :
Scaffold_11:53069- 54983
Sequence
1914 bases(100 bases per row)
CTACGAGAGAGATACCTTTACACAAAGCCTAGCGATAGTCTAGCAGATAACAATCAGAGAGTTCGTTTTACCCCCTACTGCGCAAGTCGCCGAGGAATCG
GGTCCGCTGTCTTTAAGGACAAGGGCAGTGCGGAGCTCCCCACACACATTCAAGTCCAGTTACGTGGGGATCAGTCTGCTCCGGCTGTTGAAGTGATCCA
CGTATTCCATTTCCCAGTTGGGCCCATTGCGTTGAGGTAAGGGTGTGTCCCATTTCATGTTAACGATTGATATCTCGGGTGGTTTGGTAGCAGTCGCCCC
CGAGAATAGTTTGACTGACTGCGTTTAGGATCGGATTGTATTTGGTCTGTATATTTCCCTCATCTGAGGGTGGTGCGCGTGTGAAAGTGCGTTCAAGGTT
GACCAGTACCTTGATCGCAGATTAGTTGACTGGTGTACGACCCACCGCCCAAGGGTCTAAGAATAAGTGGCGGCTGTGTGTTTGTATATTCCATTGTATT
GGTTATCCTAAAGTGGTGTGGTTCTACTCGTGGTAGTAACTGTAGTGGGCCTACCTTGGCTCACTACTACGGCTTACACGTATGCGCACGTGTATGAGGA
AGCGTAGGTTTCTTTTACTTGAGTTAAGTATACTCGAGATCCACGAGTATACTTTAAACAAGATAAAGAGTCCAAGTAGTGTGTTTTGGTAAAAGATGAG
AACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAACTAGGAATCTGCCAACGGCTGGTTGGCAGAATTCCAATGCTATGCAT
GTCACTCATTGGCTAAAAGATGCTGCATTCAGCCAATAGGAATCCTAAGTCTCTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCATTGGTG
TACCTTACACCAAGGTCGAGGAAGTGTTCAAACCTCGAACAGACGCCGTGTCTGTCAGAGATACAAGTGACTGTAGTCACTTGTGCGTGTAACCCTGTTA
CACCATCCCCCCCCCTCAAGGTTAGACGTGCCGGTCTCGGCACGTCTAACCACCATTGACCGTTTGGTCAATGCGTGACGTTTGAAGAGAGCGTGCTCGT
TCCGTAACGAGCACGTCGAAGTTGAAGACCCCTGGCGCAGCAGCGGAGGACATCTCTGCTGCTGGGTATAATGCGCGGCAACGTGCGAAGCGCGTCGCTG
CCACGGGGGCAGGACCCACAGCCTGCCCTTGAAGTGCCTTCGGGCGCTGTTGTTAACAACAGCGCTCGTATTACTTTCCAGCGTGTAGCGCATGGTGGGC
TTCGTACGCCCTCACCATGTCCGGGACGTCTTCGAGCAAGACGTTCCGCGGCTCCCATGTATCTTGGTTGGGATGGAATCCTCTCCTACGGATACGAAAA
CGAACCGGTTGCCTGTTCGTTCTCGGGATACTGTGACCAACAACCCGCTCAACTATCCATCGAGTTGAGCCGTGTGCGTCACGAATTGGCGGCGGTGGTG
GTGGAAACACGCCCCGTGTGTGGTCAACTTGGTGTTGACCTTGATCTCGCGTCTCCCCACGACCAAGTCCCGGTCGTGGAGTAGTTCCAGAGCGCTGCGT
TCGGCGCTCTGAAGTATTCGCAGTCTGCGGCGGCCTCCCAGACCGCCTCGATCGTTCCGGCCGAGCTGGACCATTAGCTCGACCCGCATCTTGCTGAAGC
GGTCAACAAAGACCACAATGCCCGTGTTCCCCTGGCTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACATGGACTGCCAACACTCCCGTGGAGTTGG
TAGTGGCTGCAAGGGAGCCTGCGCGAAAGGCGCAGACTTCACACGTTGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATTTGTACTGGTGGGCC
CAGTAGAAGTCTCG