Description :
From Genome Similarity Track
Location :
scaffold_132:53050- 55704
Transcript NameFunction/comments
g4290.t1 hypothetical protein PHYSODRAFT_310411

Sequence
2654 bases(100 bases per row)
TCCGTTGTCAACAAAGTTCTCACCTGCTCTAGCATGTACTCGATTGCATGATTCTGCGCATCCCTGTGAGGAGTCTGCTTCGGGAATCGCTCAAGTATAT
ACCTGCATTTCAGCAAATACTCATACTTGAGTTCTGGTTCGCGGTCATCTGAAAACAATAGATATCGCTTACTTTCTCACATAAAAATCTGGCATGTAAG
GAAGCCTACAGTTATCGAAACGTACATCATATCAGCCTTAGAATCAGGGAACAGAAAATTTTCGTAGTGGGTACTTACATCTTGATGCACGGGGCGCTTG
CTCCGAACACGCGAGTATCGCAAAATCCTTGTGTCATAGCCAAAGAGGCGACTCGTTGCGGATAAAGAGACATATAGCGCTGCGGATCAAGTAAAATAGT
GAGACTTCTCGATCAATCAAACTACCTTAATTAAACACACCTGTATCAAATATGCTCCAAGTGACACAGCGTACACGTGGACCTTACATTCACAGCAATT
TTAGTTAGCTCATTCGTCCAAGTAGGCCACCAACCAGCTCATTTGCACCTCCGACAAATTCATCGCGTTGAGAAATCTGTCGAAGCTGTGGATCCACTCT
TCATGTGTCCAAACAACGGGGTATTGGATCTGTTCAACTCGAGGCAATAGGGTGACAATGCGAAGACAATAGACATAAACTCGTAATTAAAAACCATACC
GCTAATACGCGAAAACCTTTTGCCCCCAGTCCTTGCAACTGCAGGTGGAAGCAGCGAGCGACTCCACTTGTTCCGGGCAGACATACCAAAGGTGGTAAGC
CAGCGTTCGCATCGCTCAATCGCCCTGAGTCATAGTACTCCCATGTGTGGCCGTCGTAGGTGGTGATACGCTGACGCGCTGTGTGCTGCAAAAATTCCTG
TTCGCTGCGCTTTAGAGGCGACAGCTCCGTTGATTTCATGCTCGATGCCAATCAAGTCTGAAAAATCTTTTGAGCTGGAAGTCGCCAACGCCCCTTGGAA
AATTGGAACAGGTTACTAAAATAATTGTGGCCTTTGAGGTTCTTCTTCTTTACTTTTGGCATGAAAATGCCATGCAAAACAACACAAGAAAACAAGATAT
TCCTATAGTACTATATTGGGGTCTTCACTCCAAATCATGCAGTTGGCCGAAGAAGTCTCCAGCTATGACGATAAGAATGTTTAACGACTTGAGCTGAATC
TCCGACGGTGCTTCCAGTTCGCACCTCAAAGTCCAACAGCATCGAAGAATCTGTCGAATAGTAGCTGCCACATTAGCATGGACAGGTTTGTCTAATCGAG
CCAGCAGTGCGTATATCCACACGGCTCGTGCTCGGGAAACTTGCCCCACATCTTCACCACTGAGCCATGCAGCATGATAGTCCAGCAGCCTTCTCGTTAA
CACCTGATCGAACTGCAGCAACAGCCTCAAGTGTGGAGGAGTAGCTGATGTGTCTGTCCCTGGTTTGCTGAAGAAAAACCTGATCCATCCATCCTCGTCG
CTCATTCTGGGCACTGCGGTGCGCAGGATCTCTACAGGGAGCTCTCCATCTTGCACGGTCTCTGCTTTGGGCGGTCCAATAGCTTCCCACCGACTAATTA
GCTGCCGCAGCTCAGCGAAATCCGCAAGTAATTCTCTCTTCCATTTACCGTCGGGAATCCGCGTTGAGTCCGTCTCTTTCAGTCCGAAAGTTTGCAATTT
TGGCATGTTGCTGGTCTGTTGGGCGTCATACTGTCTGGGGTCCACGTCTGGAGCCACTACAACATCAGGGATGCCCTCCGCTTCAAGTCTCACCCGCCAC
AGATACTCCTGAACGTCTTGAGGTGGAATACCCTGCTGCATTCGCCGCTGGATGAGTTGTACGTCCACTGCTTCCTCGCCCTCGACGGGCAGCGCCGTAG
CCATCATGATTGCTTCAGTGGTGCCTTAAAGGATTTGTGTGCGCTCAAGTGATCAAAAATTGTACATATGTATATTTTGTAATTTTGATTTGTGTGCTAT
CAAGTGATCAAAATTGTGCATATGTATATATTGTAATTTTGGTCACGACAAAAAAATGAAAGCCGTCCAACCAATTCCTTTCGACACCACTAAACGACAC
CATGGCAAGTGATCCGCTGGCCGCTGTGCAGCAACTGCAGAGCGTTGTGACGTCGCTGGCGCCTACCTTATACCCCCAAGTGCTTCCCAAGGGTGTTGAG
TACGGTCTGGATTTGATTCTGTCGTTGTGCAAGACGGAGGAGCAGCGGCAGACGTTGCTGACACTTGTGCGCAGTCAGAAACCCACTGGTGGCAACGCCT
CCAAGCCGCAGGGAAGCAAAGAAAACACGGACGATGAGGAAGAGGATGACGACTATTTGGAGCCGCAAGTGATTGGCATCTTCGACGTGGAGAACCGAGT
GTTCACCGTGCAGAAGGTGCAATGGATGCAGGAACGCGAAGCTGTGGTGCACGAATTCGCTCGATTCATTGAGCTGCAGCTGGAGAACCCAATTGCAGCC
AAGCAGGTGGTGCAGCACTTCTTAGAAGTGAACGGACACAAGCCTGAAGAGGTTACTCTGGCTCAGCAATGCTTCAGTGCTGCGTTTGCACTACAGACGT
TGCTCCGGTTAGTTGTTGCAATGGTGTTTGTGGTGTGGTCAATGGTTTAACTGG