Description :
From Genome Similarity Track
Location :
Scaffold_850:5304- 9963
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_850-fgenesh-gene-0.3WW domain-binding protein 4
Pytiw_DAOMBR242034maker-piw_contig_850-fgenesh-gene-0.4Cyclopropane-fatty-acyl-phospholipid synthase

Sequence
4659 bases(100 bases per row)
TTAGTCCTGGAAGATCCACTCGTTCTTCTGCTTCTGCTTCTTGGCTTTCTTCTCGGCCGTGACCTTCTTCCAGTCAATGTTCTTGCGCTTGAGCTTCTCC
TTGAGCACCTTGGCCTCCTCGCGGTTCTTCTCCAGGTCCGTCATGTTGAAGAAGTGGCTCATTTGACGCCCTGCGCGGTCCGGCGCCACGCCCTGCGTCT
GCCAGTACTCGTCCCCGCCGAACTGCTCGTACTTGCCCGTGAGCCGGTTGAACTTGGCGCGCGCTGCGTAGTTGACCCCCGAGACGGTCTTGCGGCTCGC
GGCGTCTTGCACAGGGTCCGAGACCTCCGGTGGAACCCAGTCCGCCAGCTACGGAATGAAAACAACAGCATGCATGGTAAGAGTTAAGCCACACATTCCG
GGAGCGCGAATAGGGAACTATACACATAACGCAAACACTCACCCCCGAGACGACGGGAGCGTCCGGCTTCTGCCACTGCGTCTCGCCCGTGACGACGTTG
TGGTAGTAGAAGCGCTGCGTGTGCGGATCCACGTGCTGCTGCCACTGGGCTTTCGAGTTCCCAGCTCCTGGTCCAGATGCGGCGTCCTCCACTTCAGCGA
CGCCACCTTCATCACTGGCACCTGACTTGATGCCACTGAGGATCGCATTCAAGCGGCCCAGGCTGCCTGTCGGGTCCAGCNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCGTCACGCGCGTGAGCCGCTCCGTGCGCACGC
GGTTCAGATGCGCCTGGTACTCTGCAGCGGCGGCCGACAGGGGCGGCGCCGTGTCTTCAAGGCCCGCAGGTTCGTCCCACTGCGTCTTGTTGCTCACAGT
GTCGTGGTAATACGGCTTCCCACTCGTTCGGTCGATGTGCTTGACCCATTTCGGCTCAACAGTGGGAAGCTCTGGGGCCGACTCGCCTGCTTCGGCTACA
GTCGTAGTAGTATGTGGGGTGGCAGCAGCAGCCTCGCCCGGTGTCTTGTCGTCACTGTCGGTCAGCGACGGCTTGGCATCTTCTTGTGGCTGTGCCTCTC
GCACTGGCGCTCGCTCCTCATCCTCCTCTGAGTCCTCATCGCCATCACCACCCTCGCTCTCATCGTCTACAGTATTAATTAAACACGGCACGTGAGCGAC
CAGTAAAACCATCACAGCTGGATGCGATGCATGTAACAATACCTGACGCGCTCTCGACAAAGCCCTCGGGCTCGTCCCACTGCGTCACTTCGTTGGCTTG
GTCGTAAAAGTACGCCGTCCCCGTGCTCTCGTCCACGAACTTGCGCCACTTTGGCGGCTGCTTGCTGGCGTCTGCGGCAGGCTCGACGAAGCCCTCAGGC
ACGTCCCACGACGAATCGCCCGTACGCGTGTTGTGGTAGTAGACCGCCTTCGTGTCGTCGTCCACGAACTTGGTCCAGCCGCTCGCAGCGGCGGAGCTGC
TCGTTGGAGTCGCCATTTTCGAGCCGATAGCGAATTGTGTTTGCATCCCAAAACAAAAGCATATTCGGTGACAATTTACATAGTAAAAATAAGTGTCATA
ATTTCATTTGTGATTGTAATTGTGCACTAATGCAAAATAATTATAATCTGGGTTAAAAAGGTTAACTATCCTGATTTAGAACCGACGGAGTGCCTAGTTT
AGGTTGACCTAGTGCATCTACCGTAGTGCAGCATTTTAGGAACTTTGCGAGGTCTCAACCCGATCATGAGACCTCTTGTTGGATGAAGCTTGCAGAATTC
TACAAAGTATTTGAAGAAGTTCACAAAGCAACGCGAGTGAAACTCGAGGAGGATGCGACTTCTGAAGAGAAGCGAGGTTGCTCAATCTTCAGACAAGTAG
TATTCATTTATTTTTCATCAGCTTCGAAGTATTCACGATCTAGGACATCTGCACTTGGAAAACCTGGAGCGCCTGCGCGCGGAAGCACGCCGCCGAATGC
AGCAAGTAGAACTCCCACGTGCGCTTGAACGACTCGGGCAGCGTGCGGTCGAGCGCGCGAGCAGTCTCCGAGTCGACCGAGCCGCCAAAGGAGCTCAGCC
GCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCGGCGACCCTGGAGCT
GGCGCTGACGCTGTTGTTCCCGCTGCTGGCTCTCGTCGTCGTCGTTCCAGCGCGCCTGGAAGCGGCGGTGCCAGTCCAGGAACGTGTGCTCATAGTGCTG
CGAGTACGCGGCAATCTCGTGGGTCGTGAATGCGCACTCGTTCACGAGCATGCGGAAGTGGTTGAGCGTTACCGGATAGCACGGGAACGAGCTGTTGACG
TACTTGTTATTCCAACCGTGGGTCGACGTGCGCGCGACCGAGCACGCGATGAACTCGAGCACCATCACAGCGTGGGCCTTCTGGATGCGCTTGATGGTGC
GCAGGAAGCGCAATTTCTGCGCATCCAGCAGTGCTTCGACCACGCCGCTGCACACGATGCGGTCAAAGTTGGACGCCCGGAAGCCGCTCAGCGTTGTGAG
GAGCTACAGACAGACAAGAGGATCAACGCATTAGAATACACATAACACAAGTGAATAGATCCAGGTACACACACTGTACCTTCTCGGGAGTATCTGCGAG
GATGAACTCCATCTGGTCGAGGACGCCGAGCTCGCCTGCAAATTTCTTGGCGTGCACAAACTCCTGGATCGACGAGAGCACCGAAACGACTGTGAGGTCG
TCGTGCTTCTGTGCGAGGTAGCAGCCAACGCCGCCCCAGGAGCCAATGTTCAGGTCAAGGACGCAGTGGCCAGGCTACAAGTCAAGTCAAGGACAAAGGT
TAACGTCAACTTCAAAGACTATGAAGTTCTGTGATGGCTCTGAGCGTACCTCCAGCTGGAGCTTCTCGTCAATGCTTGCGAGTTTACGGGCTTGCGCTTC
CTGTTCATGCAACAAAGCGAGTGCCTATATCAGCATTCTGCAGTCGAACAAAAGCCAACAGAGATACCTGTGCGCACCTCAATGTTCGAGACGCCGTTGC
CCCAGAGACCAAAGCCCTGGTGCAGGTACTTGTCCATGTAGTCTCTGCGGAACTTTGGGCAGAGGTCGAACTGCTCCGAGGCCGCGCCGACAATGAGCCC
AACGGACGACGGCGCGTAGTTGAACAGGCGTGCAGCCAACGCGACAAAGCGCGCGCTCCACGAGCGATACATCTCCTGGCGCGCCTCCATGGGGATCGTC
ATGAGCGCCGCGATTACTTCGTCCAGGGTCTTGGACGCGTTCACCGCCCACAGACCGCCGACGTACGACTCGCCGATCGCCACGAGCCCATCGCTCATCC
AGTCGAGCCAGAACGAGTCGTCGCGCACGACAAAGTCCTGTTGAGGCATCATTGTTATTATAATCACACAAACATCGTCAGGTTTTCCTGACAGGACAAC
AATTCAGATAGAGAGATAGGTACGCACCACGGACGGCTGAATGCCTCCGCTGGACAGCAGCCTACTCATGATCCCCTTGGCGTTGTTGCGGAGCTTTGGC
AGCGACAACGAGCGCACGAGCTGCAGACTGCAGAGCACACCGCCCGCGAGGGCCGTGGCCACATACACCCAGAATGAGCGCTGCTTAATAATAGGTAATA
CATACACAGTGAGCTAAGCAATATGCAAGAGACGTGATGATTACTCTGCCATTTTCTGCTGAGCAACGGTTGTCAGCGAGCTGCGTACCTGGTGCGCCAG
GACGCAGAAGAGCGGGACGAAGAGGTTGAGCATCAGCTCCATCTTGTACGCCGCGTTCCAGAAATGCTGCGAACGTGGGGGCGAGAACCGGTAGACGTGG
TCGGCTTTTGGGAACATGCCGCCTCCCACCACGACATGACTCCATAGGCGCGAAGAGCTACGTAACACATATTACAAACCAGCAAGCATAACGACACACT
TAGCAAGCTGATGGTAGCATCCACACATAACAAAGGCAAGCTTGGTACGTACACAAGCGCTGGGATGCACATCCAGATGCGCACGAGCGGCAGGTAGCAT
GAGATGAGCAGCATCGGCAGCAGCAGGTGGATCATGAAGTCGCCCACGCGGCACAGGAAGCCGAGCGCGGGCGAGCCCGCCCACACGCCCAGCCAGCCGT
TCATGACTGCCGTGAACGCGTACCGGTCGAAGACGCGCAGCGTGTACCAGCCCACCATGATCGTGATGCCCATGGACGTAGCGATGCCCAGCACGGCCTC
GGACTTGGGGAGCACGTGGCCGGCGGCTGTGAAGAGCAGCCAGCAGACCGTGTACATCATGCGCACGCGCAGCAGCGGCGGGACCACGACGATCGCGAAG
AGCAGTGCGGTTGCGAAGAGCGCGTCCATGCGCACGTCGGCGACAGCATTACTATTGCC