Description :
From Genome Similarity Track
Location :
Scaffold_27:5304- 6453
Transcript NameFunction/comments
Pytar_ATCC12531fgenesh_masked-par_contig_27-abinit-gene-0.66RNA polymerase II-associated protein 1

Sequence
1149 bases(100 bases per row)
CAGCTCACCGACGACGAGATCACGGACATTGCGACCGCGGGTGTGTCGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGTCCGTCGTCCAACCT
CAAGCTCGCGTCGGGCATTTGTCCCGTGGCCAAGCTGCTCGCGAGTGGTATCAATGTGGCGATCGGCACGGACGGCGCCGCGAGCAATAACTCGCTCAAC
ATGCTGAACGAGACCAAGCTCGCGTCCATTCTTGCCAAGGTGCAGGCAAACGACAGCACGCAAGTGCCGGCGGCCACGGCGCTGCAGATGGCGACGCTCA
ACGGCGCGAGAGCATTGAGACTCGAGCGCGAGATTGGCTCCATCGAAGTAGGCAAGCGTGCCGATCTGGTCGCGATCTCGTGCGACGACATTGAGATGAT
CCCCATGTACGATGCCATCAGCCACGTCGTCAATGTCGCCGGTCGGGAAAAGTACGTCACGCTCGCGGGGTTTAATGATGGGGAGTGACTGGGGGTAGCT
GATCTCTTCTTGTCTTGTCTATCATAGTGTGTCGGACGCCTGGGTTAACGGCAAGCACGTGCTCGCCGAGCGCAAGCTCGTGACCGTGCGCGAAGCCGAC
ATCAAGCGCGACGTCGCCAAGTGGAACGGCGAAATCCGCACCTTTCATGAGGAGCTCCAGCAGAAGAAGCAAGCGTAGACAACAATGGTGTCACCACTGT
GCACGGACGAATTCAATCTGAACTGGTGTGTCTTTTCACCCAGATGTTGCTAGTCGCTATCGGACAGGGCATCAAATGCGTCGCGGAGGATGCTGTGAAT
GTGCGCCTCCGTCATGGCCGGGACTTGCCACGAAAAAGACGGCTCGACGGCGGTGGGCGTGGCTTGCGGTACGAAGCATTCCCCACTCAGTCCTTCCTCT
TCAAACTCAGCGAGTTCCGGGACTTCTCCAAACTCAACGGGTACCTGGATTTTGACCTGCGGTGTATCGTCCTCGGTCTGATTTTGAGAAGTTCTTGAGC
TCGAGGGAATGTCGCATCCATGGAGCACTCGCTTGAGCAATGCCGCTCTCGACTGAACACGCAGTTTTGCCTTTGCACGCGCTCGGGCGGCCTGGTCGCT
GTGCACTCGCTCGTCGTCGACAAGCTGCTGGGACTCTTCTCGCCTGAGC