Description :
From Genome Similarity Track
Location :
Scaffold_12:530327- 537758
Transcript NameFunction/comments
Phyra_75414bzip transcription factor
Phyra_75415Hypothetical protein

Sequence
7431 bases(100 bases per row)
GAGCCTTGTCAAACACGCACGAGACGTCCTCCAAATTGCCCAGAAGGCGCAGCATTGGAGTCAGCATGTCGGCCTGACTGAAGACGCCCTTCACTCGGCC
GTACGCGGCATCCCACTCAAAGCGCGTAACGCCGCGCATGACTATCCTTTGGTTCAGCAGCTTTTCCGCGAGAGCTGCTTCTCCACCCCTTGACAGGTGT
GGGAACACGTTGCGCAGGGTTCGCTCAGTAATGGTGACACTTGTTGTGGTACTTGTGACCAGCGAGTCTGCAGCACCTTTGTGCATGTCTTCAAGCTCGA
GCTCCACGTCTTGAAACCACATTGACAAGCATTTCCAGCTCTTTGCCATTGACTCTGGGCCAGATCCTGCGCTGAAAACCACATCTGCTGCCATCACAGT
CAGTAAGAAATCTTGCTGCACAGAGAGCTCGTTTGCTGAAGAATGTGTCGCTGTCGATTGGAGACCATAGCGGAAGAGCCGAAAGTACTCGGTTGCCACG
TTCCAGACACTTTCCTTTGCCGAGGTCGCTGCTGACGCCGACCGACGACGCTGTTGCAGCTTCTCCACCTCCTCTCGTAGCCCCCGAGCTTCCTCTTCCA
CAGTATTCGCGTGGTTTTCTTTCTTCTTCCGGTACCGGATCTGCCTCATTCGACGCATTTCTCGAACCCGCCACCTCTCGCTGGTGATTTGTTCCGCCAC
GTCGCTTTCATTCACCGAGGCTCCATCCTTCAACGACAACTGCCTCCTTCCATTGCCCGTCCGTGAAACGCCACCGCCAATGGCGTGTCCAAGTGAACCA
GAAGACCAATGTCCATCACGAATTCGAGTCAACTCAGTGTCGGCAATAAACCAGTTGTCCATGTTGGCGACTCCACCTCGCTCCGTTCGCTTGGGCCGCA
GCACTGCACCACGGACGATGTCGTCACTGAGAAAATGGCTGTTTGGCGGGCGGAGGATGCAGGCGTCCATCACTGAGTCAGGAATACGTGGATCGCAAAA
TGACGTTCCGATCAACGGAGCGTGTTCAATTTGGATCCGCTCGCCTGCGCCTACATACCTCGAGACGATGGACCGGCGCCATCTGCTTCTTCGGGGAAAC
AATGATGAGAAATCTCGATGTGCTCTACTGTACATGTAGAAGCTCGGCTTGTACAGTGTAGATTACGAGTTGTAATGTCTGTGTAACAGACACGTTCGGT
TGCAACTGACTGAGCTGTCCCTGACCCCTCCACGCCACTCGTATAAATCCAGCGTGGTTGTGCGAGCGACGAGCTGCACGTACGCGTAGTATAATAGTGT
TGTTGCCAAGGAATAAGTAGATTCTCAAACGTAAGTTGGTTTCTGAAACGTATAAGAAGATCGATACGTTTCGTGGACATGAAGGTAAGTGTGCTGTCAT
ATAACCAGACTGCTGTGTGAAGCTACACTGTACCGGGGTAATAGCAGCTAGCGGCTAGACTATTACTGGCTCTCGGAAAGAAGCGGGGGCTTTGTGTCGG
ACATGCTATACGTGTAATAGCGCCAAGCGATTTCCTCTCACGAAGCTCCTGTCCATGGAGACCTCAGCTCGTATCATTGCAGATAACGTTTAGCTGAAAC
CTAAGGCCATCGGTAGCGCGCGGACTCTACTCTGCCTGCAGGCACTCGTGATGCTGATTCTCGGGTAAAGCGTGACAAGGTATTACGACTATCTCTTCAT
GCCCGAAGAATGCAATTTTGCAGTATAGTAGCAGAATTCATGCGCTAAAGAAGTCAGAGAAAACCAGTAGTATTGCTAGATTCCGATGGTTAGGCTGGGA
GATTTACTTGGTGTGCCTTTGGGTATTTAAAGGTGGGACATCAGAGACACGATGGTATCAGGATGATGTGGAGCAACCATTTCATTGATACGTTCACTTG
CCATCTATGTTTGTGCGTGGCTTCCACTATTAATATCCATCCAGCTGAATCAATGTAGGCGTAAGAATACCAGGACACGCTACATGTACCTGGTGAAAGG
GCTTTTTACCCATACAAACTAAAGAGAAAGCTGACACTTCAATCGTTCATATAGATGCATGTGTTTCGTACTTGTCGCTCGAATGTCGGTCCCGTTGAGT
TCGGTAGCCAGCTCGCTAACTACCTCCCAGTAAAATGTACTTACTTAGTGCATCTACCAACATGCTGTGATAATCTCATAGACAAAGTGATTTGCAAAAA
TGATTAGCAGCGATGCTCTAAATGTAATGAGGACCATAGCCTGAGGCTGCTTCGGCGCCCCGCTGTTCGCCGCGGTATGGAGATAACGTTAAAGCCTTCT
CGCGAGTGAAGTGCACTGTTCGGCAATTGAGTTCACTTCCGTTGGCTCGATGTCCTTTAGGTTTGTTTTTAGCTGACGCACCCGCTTGTTCGCGGTGAAT
CCATGAAATTCACGCGATCACCATCGCGCAGGATAATTCATCTGCTCGCTCGTCATTCCGGTTGAGAACGCCGCTCGCAGAATGCTGTGCAAGTTCTTTA
ACTTCGTTAAAGTATGGCCTCTGCCGAAAGCACAGCCCAGGATTAGAGATTCTGCACAAACGTGACGATCCGCGTCTGTTTTGAGTCTTCCCACCGTGTT
TACGGCTTTATGTGAAATATGTGCGCGCGTGAACCAGAGAGAGCAAGCGTTCTGGACTGGACTTCTCATTCCTCAACTCGCCTCGGCATCACCACTCAGT
TGTACTAAGAGCCCGGAAATGGACACGTGCCTTCTCCGCCCGCCTACCCGCAAGGTCCTAAGTGACGACATTATCAGCGGTGCGGCGCAGCGCCCCCGCG
GCTTTCGGTCGTACGCTCATGTCGAGCAGCCCAGTCGACCGACGTATCCCACCGAGCACGTGGCGATGGGGTACCCCCACCCAACTCACGCGTACTACAC
AACACCGGAACACAACTCGGCAGAAGGACCCATGGACAGGAAGAGGAAACGGCAGGAGTCCACGGACTCCACGCTGATGCTCTTGGCAGTTTCCAGTGGC
GCGGCGGAAGGTGGTCCCGGTACAAGTAACAACCAACACGTCAGCACGGAGTGGCTCATGGCACAGCAGGAACATCAACGGGAGATCCGTCGACTGCGCC
AAATTCGGTACAGGAAGAAGAAAGAGAACTACGCGAACACCCTTGAGGAGGAGACCCACCAGCTGCGACAGGAGATTGACAAGCTGGAGCAGCGTCGACG
ATCGGTCTCTGCTGCTGTCCCAAGCGAGAAGACGCTCTGGAACGTGGCGGTCGAGTACTTCCGCCTGTTTCGCTACGGTCTGCGCGCCTCGGACTTGTCG
GAGCAAGCGGCCAACTCGTCAGAGCCTCAGCCGTGCGCTCAATTAGATTTCCTGCGAGCGGCCATGGCCCCAGACGTCATGTATAACGCTGGACGCGGCA
TCGACTCGATCATGACGAACTGGAAGTACTTGTCGCTGTGGTTTCAGGACGTCGAGGTCGAGCTGGACGGCTTAAAAAAGTGCGGCGTCGACGCGCTGAT
CGCCAAGACGACAACCAAACTCACCATTAACAAGCGGGCGCTTGTCACCGTGTTCCCGCACCTGTGCAGTAAAGACTCCGGGGCGGCTGGACTTGAGCTG
GTCAAGAAGCTCTACGGAAAGACCATCACTATGCGTGGTTCGACGCGGTTCGAGTGGGACAGCGGCTACGGTCGCGTGACGAGTGTGATTAGTGAGTCTG
ACATGCTCACGCCCATGCTGCGGCTGCTAGGAAGCTTGGAAGGCGTGTCCCGAGTGTTTGAGAAGTCTCTGATCTCGCTAGCTCCGTATCGGAGTCAAAA
CACTGCTGCGCGTCAAGGAGTCGGCCGCCAGTGAGGAGAGTAGCAGAGCAAAGTTAGGTAGACATACTGATATGAATCACAGCTCTTTTGGTGAACTAGT
AACCGCTTTTTCCGATGGCATTCGGTCAGCTGGACCAGCGTTTGGCTAGCTCGGAGAGCCAATTGCATTCGAACAGTCCGACATCTTCAGTGCACAAAGC
TGTAGAGCCACTCTTGTCGACTATTGACCGACTCTCGCAATTCATTTGGTTCCTAGCAAAGCGTACACATAGCATTGTTTGACATGCGCTTGCCGAGCCT
TTTCGTTGCATGGACTTCCTAGATGCGAGAGTCGGTCGATGGTCGACAATAATGACCCTACAGCTTTGTGCACTGAAGATGCTGGAACTGGCTGCGAATT
TCTAATGTTTTTTTTTTACCATTTCAAACTGACCAATCCGCTCTGCTAACGAAGTACCGTCAGCACTTTGAACCTCTCCGTCGTACTGCAGGAGCGACTT
TAACCAAGCTCGGATTGCGCTTCCGTAGCCACCAACGTAAACGTCATGCCGTCTGAGTGTGCTGCACAGCCTCGGTGTCCAAGTCGGATGGGCAGCGCAG
TCTCGTACAGTAAGCGCTGAACATCATTTGTCTTGCAGTCGCAATTTGTGAGCGACATGCTTTCGCCTGGGAGGTTTCACTGGGACCACTTCCAAGGCTT
TTTTTTTTTTTTGGGGGGGGGGTTAAGAGGTCCTCTATTTGTGTTTAGTTAAGAAACTATAGAGACCGCTTCCAAGGCTTATACATCGTATCCAATGCTG
TGACATTCTACAAACTGACCAGAGCAACTCCCGAATGGACAGCACATAATTGTCAAGGCCTGGATTGTATACGTGTGCGAGCGAGCAGGTTCCGAGACTA
CTGTATATCGCCGATGCAGATTGAAGCTGTCGGGCAACTCTATCCGGCACCAACACAATTCTTTATGAACAGCAGTGCGGTTGTGGTACCTGCATACGTT
TCTCTCCGCCGTTAAAAAAACTGTCACGGTTCTACAGGCACAGTAACAGCAAGTGCTGCTTACTTTGTCCGCTGCTAATGTCGGCTGGATGCTATCGTAA
TCGCTACCGCGTTATCTGTAGGAAATCGAGTCAGTGTCTACGCCGCATCACCCACGCTGGCAAAGGACTGGCTGGTGGCAAGCAGGGTGATACATGCACA
TGTATGCAGCTTCGGTCTTCGTGGCTTGAATTCAGAGAGCAATCTTGCCTTACAACTCTTCCAGCTTCACTTGTCCTACATATTCTCGGCAAGCCCAGCC
AGGAGCCCACCATGTACAATAAAATGTAACGATGGCAGATGTAGTCACGATGGCACACTGCTAGCGGTGTCTCACGAGTAGACAGTCGCAGTCATGTACC
AGAACAGACAAACTCCATGGTAGTGATAGAACCCTGTCTAAGGGTATTCCTATCGCAGGGCACAGTATGAACCATAATTCGACAATCACCATGCTACCAT
TACGTTAAGGTCACATTAAAGGTCCCAACTGTCGGTTTGCTGAACGTGTCATTACAATGCTGTCGCGCTTGTAGTGTGCTTCATATTCCTGTTGAGAGCG
TATTATAGGCCTGTAGATCACTACGCAGGGGTTGCAGTACATGCTCGCTTGCAAGCGGTTCACATGCAGGCGATGAGGATGAGCTGATCCTATACATATT
CCACGAAATATAAGCCGGGCTGCTGGGCGAGGCTATCCAGCACTATGGCACTCAGTATTACTGTTTGTTTGTGCAGGCCCCATAAACAGTTGTGCTGGTT
TACTTGACATTTGCATTCGCACCATCTTCTAGCAGATCAAACAGATGGTTTCATTATCTCGACGTTATCCCCTGCTATATGTCATCAGCTTTCTTCCCGT
CCAGGGTTTGATACTACAGTAGTAACCGTTAGTACTAATATGCTTTGTACTAAGACTAAACATATCATTCCCGGACATGGCTGAAAGACGAGTCCATCAC
GAACCATATAGAAATGAAAAGTCGCACGCAAAAGAACACCGGATGTTCTACAGGGCACTGTTTTCAAACTGCACACAGGACGTAATTTAGCGGCTACTAC
TTGCAGCTCGCCTAACCATGAGAGTATATCACCGTCTGGCAGTGAATTGGAGCTCGTATGCTGTGGTACACTTTCGCAGCTCCCAATCATGGATGCCTTG
GACCCGGCGAGTTGGTGAAAAGTTGCACCAAACAGGGGAAAGTAGCGTATGGAACTTTGATCAGCTGTGTGAGCGCATTCGTTTCGTTTCGCATTGATGT
GCATTGCTGCCACTTAACTTCTTTTGCTCTATGGCCTGACCTTGTCGTCAGTTATTTATGCTTTAGCAATTGATGTAGTTTGGTGTGTAAAACCCAACGT
TTACAAAGTTACAGTTAGTAAGAGTTTGGATGGGCCCAAGCTCGTCGAACTGCGTTCCAAGACCGCGCGATTTCAACGGGGTATTTCCGCTGTGACATCG
TTCCGACGAAGAACGAGCGCAATGTCAGCTACATTTAGTGCTGCAGCAGAAATCCAGCGCGTTGTGGGTAGTGCGGGTTTTAGTGGTCTTAGTAGTCATA
TTAGTAGGCAAATTAATCTTAGTAATAAGAAGAATTCTCAGTTAAGTGGAACTAAGGCTAATTCCAAATAAAAACTGAATTCATATTAATTTTACAATAA
TAGTACTAAATCCAAGAAAAACCCACTACTATCAAACCTTGTTCCCTTTGGATTTAGAAGGCCACATTCAGTCTTTCACCAGCCTTCAGCCCCCCCCCCC
CCCTCCATCAAGTGACAGTCTCCATGGACATGTGTGTTCTCCGCCCACCCAACAGTCAGCAATTCAGCGACGATGTCATTACCAGTGTCGTCCAGCGCTC
CCGGAGCATTCGCAACTCGCTCGTCGCCGTCGCCAACGTCTTGAGTCCGGACGCTGAATACCACCCAGCGCAACACTCGGACGCGCACACACCCGACAGA
AATTCGTACCCGACACGTGAACATGAAGAGACGGGAGCCTCTCCGCTGAATGCTCCTCCAGGACGTTGGCGGGCCACCTCGCCTCAGAGCAACTCTACAT
GCATGGCGTTCACAGACCAGAAAAGGAAGAGGGAAGACTTGCAGAGTTCCGTCTCGATGTCATCTCCTACTGCTGGCGGTGGCGTCCCCGGGAAGACTGT
CCTGGTGAAACACGAAGACCAGCTTGCAGTCATGGCCAGACTAGTCATCTCCGAGAAGCAGCGGATTCGTGGGCTCCGTCGGATGCGGCAGATACGATAC
CGCAAGAAGAAAGACAACTACGCGCTGAGTCTTGAAGAGGAAGCTCGACGATTACGCGAAGAGATCGAGAAGCTCGCGCAAGAGCGACGAGCTGCGTATG
TTGTTGTGTCTGCGGGCGAGTCTGCCTGGAGCGTTGCAGCGGAATACTTTCGACTCTTCCAGTACGGCATTCGTCAGCACACATCCACTCTACAAGCAGA
CCAAGGAGCTCAATCCAGTGTGTACGGTAGGTTCTTGAGATCGACGGTGGCTCCAGACGTCGTCTTCAACTCAGAGAGCGGGCAAGAGGCAATGCTGACG
AGCTGGAGGAGCTTATCGCTCTGGTTCAAAG