Description :
From Genome Similarity Track
Location :
Scaffold_7:530117- 534963
Transcript NameFunction/comments
Physo_108370ATP-binding cassette sub-family B member 7
Physo_129317hypothetical protein
Physo_155718hypothetical protein

Sequence
4846 bases(100 bases per row)
CATGTCGCTGCTCCACGGGCGCAGCATCTTCCTGCGCGGCGTGCGGCGCCTCGAGGCCGTCCAGCACGCGCGCTGCACGCCCGCCTCGTCGTCCTTGTGC
CTGGGCAGACGCCGGCCCGCGCACTTCGCCCTCCCGGCGCTGGGCAACGGCGTGCTGAGCTTCTCCACGTCGGCGCAGGACGAGCGCGACCAGCACAAGA
AGACTCTGACCAAGCACAAGCCGCTGAACGCGCTGAGCGGCATGGGCCTGGACCGCCCGCCCGACACGGCCAAGGAGATCCTGAGCTTCCTCATGGGCCA
CCTGTGGCCCAACGACGACTCGAAGGAGGCCAAGGAGATCAAGCAGAAGGTGCTCGTCTCAGCAGGCCTCGTGGTGGCGGCCAAGGCGCTGACGATCCAA
GTGCCCTTCATCTTCAAGGAGCTAGTGAACAGCATGGGCGACGCCTCCAGCGCACTGGCTGGCTCGCCCGAGATCGCGGTGCCGCTGGCCATGGTGCTTG
GATACGGCCTGGCTCGGTTGAGCGCCAGCGCGTCCTCGGAGCTGGCCAACGGTGTGTTTGCGACGGTGGCCCAGAAGACCATCCGCAAGGTGGCCGTGCG
CGTGTTCAACCACTTGCACTCGATGGATCTGAAGTTCCACTTGGACCGGCAGACGGGAGCGCTCTCGCGCATCATTGACCGTGGCTCGAGGTCGATCGAC
TTCGTGCTGCGCGCCATGGCGTTCCGCGTGGTGCCGACTGTGTTGGAGATTGGACTGGTGAGCACCATCATGGCTACGAGCTTCGGACTGCCGTACGCCG
GTGTGACGCTCGGAACGCTTACTGCCTACACGACGTTTACGGTTCTCGTTACGCAGTGGCGAGACGAGATTCGTCGCGAAATGAACCGCCGCGAGAATGA
GGCTGGTGCCAAGGTCATTGACTCGCTCATGAACTACGAGACGGTCAAGTACTTTAACAACGAAGAGCACGAGACTGCGCGCTACGACGAGTCGCTCAAG
GGCTACCAGGAAGCGGCACTCAAGACGCAGACGTCGCTGGCGATGCTGAATGCTGGACAGAACGGCATCTTCAGTGTTGGTCTCACTGCCATCATGTACA
TGGCGTGCGAGGGTATCGCTGCCGGCACGCTTACCGTCGGTGACTTGGTGCTTGTGAATGGTTTGCTGTTCCAGCTGTCCATCCCGCTGAACTTCATCGG
CAGCATCTACCGTGAAGTACGCCAGTCGGTGACGGACATGGAGTCCATGTTCAAGCTGGGTGCTGTGGCACCGGTTATCACTAACCCGGACGAGACGTTG
AGTCTCAAGGGCAGGGAGCCCAAGTCGATCGAATTCCGGGACGTGGATTTCGGTTACCGGTCTGAGCTTCCGATTTTGCGCAAAACGTCGTTCAAGGTGG
AGGCGGGCAAGCGCGTTGCCATCGTGGGCACGAGTGGCTCCGGCAAATCCACGGTTCTCCGCCTGCTCTACCGATTCTACGACCCGCAGAACGGCTCAAT
TCTTATCGACGGCAAGGATATCCGCCAGCTGAGTCTGGACGAGCTGCGTCAGGCGATCGCTATCGTCCCGCAGGACACCGTGCTGTTCAACGACACCATC
TTCTACAACATCAACTACGGTCGTCTGGACGCGACGCCGGAGGAGGTGATGAATGCCGCTCGCGTCTCGCAGATCCACCGCTCGATCGAGTCGTTCCCCG
ACGGATACAACACGCGCGTGGGAGAGCGCGGTCTGAAGCTTTCCGGTGGCGAGAAGCAGCGCGTGTCGATCGCTCGCGCGATGCTCAAGGACTCGCCGAT
CCTGCTGTTCGACGAGGCCACCAGCGCGCTCGACTCGGAGACCGAGTCGGAGATCGTGCGCGAGTTCGCGTCCATCGGCGAGAACCGCACGTCGCTGATC
ATTGCGCACCGCCTGTCGACCATCCAGGACGCGGACGAGATCATCGTGTTCGACAAGGGCCACGTGATCCAGCAGGGCTCGCACGAGGAGCTGCTGCGCG
ATGTTGAGGGCAAGTACGCCGAGATGTGGGCGCGCCAGAACCACCACGTGCTCGGGCTGCTCGGCAGCGGCGACAACGAGGACGAAAAGGTGTAGAGGAG
ACGGAGGAGAGTGTGTATAGATCCCGTCGTGTCCCGTGGAGCTACTGTTGCTGTAGATTTCAGCAAAAAAGGCAACAAGAGGCTTGATCCCGTCAGTTTC
TACTGTCAAACTTCATATTTCAGTCCTAGCTTCAATTTTACGTTACAACCTAAAATTGCGTCTGCTAGAAATAGCGGCAGCGCATCGCTCCGTCGTTGGC
CGGCATGGACGCGCTGCTGCTGAGCGCACAGCGCCTGAGCGCCAGCTCCAGTAGCAGCCCCAGCTCGAGCTCCAGTTCCTACAGCTCCAGCGACGACGAG
CCGCTCAGCGTATCCCTGGCCAAGCTCCACAGTCCGGCGTCGAAGCCTCCGCCTCCGACGACGGTCGGTTCCAACGGCATGACGAGCCCCCCGCCCCCGC
CGCCGCCCGACTCTCCGCCGCCTCTGCCACCGCCGCCTCCAGGACCGCCCCCAGCGCTGAAAGGCGCCAAGCGCAAGCCAACGCGGCGCTCGAAGACCAG
CAGCAATAGCAGCGGTACAGTCGCCAAGAAGAAGCCGGCCGCAGCTCGTAGTATACGCAGCACCGCAGCGACGCGCAAGGCGCCAGTGAAGAAGAAGCAG
GAGGTTGAGACGAAGCTGCTGGTGGAGGAGGAGGAGGAGGCACCCACGGCGGAGAGTGTACAGGACGAAGAGGAGGAAGAGGAACAGGAGGTGGAGGAAG
AGGACCTGGACGCGTACTCGGACGAATCGGACGTGTTTGAAGAGGATGTTGAGGCCATTTTGTTTGCGGAAGAGGAAGAGGACCGGCGCAAGGGCTACAC
GGACTGCCTCACGGAGACGCACCTGGACAGCGTAGAGTACCCCTATCCAGCGTACCTCGCCAAGCTGTCGACGCTGTTCACGAAGCAAAGCGCCTTTGGG
AAGAACCCTGAGGACTTTATTTATTGCAATAATCTGCTGGTACGCTTCGTGTGGTGAAGGTGCTTGAAGATGTCTTAATGGAGGTTAATGGTGGTGTTGT
GTGCTGCGGATGCAGGTTAGTCCGGGTCAGTTGAAGCTCCTGGACACTCGAAGTGCTGCGATGGAACGGGAGAAGTTGCAGCAAGTGCAGGCGGCGGCTG
CACTCAAGGCGAAAGAGGAGAAGAAGAGGCGGCGCCAAGAAAGGTAAGCGATGTGTAGCTGAGTTGCACAGTGCAGTCTCTCCAGCTGTCCACGGTATTA
ATCCTTGAATGCTTTTCGTCACATTTTGCAGGTTAGCGGAAATGCTGGAGCCGCCTGCCAAGAAGCTCAAGATATCGGAAGCTACTCTGAAGGCTCTGGA
GTCAAAGCAGTCTGTATCCATTAGGAGCTCTAGGCCTGCAGCTAATCCAAGCAGGAAGCGAAGCCGAAAGAAGCCGGCGACAGCAACTGCGGCTGCAGCG
GTCCCTGCATCAACTGCAGCTTCTTCAAATCCTCCCAGCGATGTTTCGGTCGCTAGCAGCAAGCAAACTGTGACGAAGCCAAAACCAACCTCGACTAGCA
AGGCAAATGGGAAAACGAATGGAAAAGCGGCGGCAAACACGCCAGCCAAGAAAAAGCCGACTGCGTCCACCAGCCGTACCAAGAAGGCTACAACTCCTGC
GGCCAAGACATCTAGCAAGCCGGTTGCTGCCTCTGCAAGCACATCCAAGACAAGCAGGAATGCGAAGGCTGCACCTGCTCAGCGAAAGCGTGCGGCTGCG
ACTAGCGCTTCCAAGGAGAGCAAAGTGCAGGCGGAGGTCGAGAAGAACCGTCTTGAGGCAGAAGAGGACCCGGGCAACGTGAGTTCGTCCTCGTCTTCCT
CTTCGTCCTCCTCGTCATCTTCCTCGTCATCTTCGTCCTCGTCTTCGTCCTCTTCTTCTTCGGTCTCTTCAAGCAGTAGTTCCTCCGACGACGACACAGG
AGATGAATAGGAATGCCCAATCAATTAGGCAGCAACAACAAAATCGAGTCCGGATCCAAGTTAACGCTTAAATTTAAATGCCAACGTGCTCGGTTTCTCA
TAGTGCGGTCTGCTGCTGTTTCTTCTCGGTATCCTTCAGCACAACCGACGCCTGCTTGTCCGCCCAAATGGTCGACGCCTTCTTGCCCAACTCAAAGAGC
TGATCCAGCACTTCGACCTCCGGTGGGAACAGCGCGAAGCGAGCCAACTGCATGATGTTAAACGGGAACTCTGGGTCAATAGACGGACTGATCTCGTAGT
CGTTGCGGCGCAAGATTTCAGCGTGGAAGGCGCACACTTTCGTGTACCCCGGCACTTCCGGCACCAGCGTGAAGAGGCCTCCGTCGACGTGATACTCTCC
CCGAAACACCGACGTGCCTCTGTTGGCCAAGTACCAAGGCACGTAGCACGACGCGATGACCGCGTCGCACAGATCTTCCGGCGAGTGGAAGTCGTCGGTG
AGTACCATCGCTCGCTGGGGCCACATCTTCTCTGTGGCGATCGTGAGCCTCTTGGCCAGCGTCTCCACGGGGACGTCCCCGAACTTGACGCGGAAGATGG
TGCGCAGTCGCTCCTCGAGCTTCCAGACGGTGCCTTCGCTGTGACACAGTCTGGCCATGGCTTTGGTCTCTTCGTGGATGTCTTCCATGCTGACGTTCGC
AGCCAGACTCAGCGCGGCGATGGAGCCGCCGGACGCACCGGCGAACTTGGACTCGGGTCGGATGTAGCCGGCGTCTTGCAGCCCCTGCACCACGCCCAAG
TGGTACGGGATCAGGAACCCGCAGCCGCTGAAGCTGAAGTTGTGTG