Description :
From Genome Similarity Track
Location :
Scaffold_770:5301- 6741
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_770-snap-gene-0.7Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_770-fgenesh-gene-0.060S ribosomal protein L6

Sequence
1440 bases(100 bases per row)
GACTGAGCTGGTAGATCCGCGCGGTCGTTGCGAGTGCCTCCTCGGCTACGCGACGTAATTCAGCTTCTCGTGCGAAGACTTGGTCTAGATCGTCGTCCCA
GAGTGCTCGCTGGTACTCGTGGTAGGCGCGCCGTGCACAGCGCACGACCGTGCGGAGCACTTGCATCTCCAACGTCGGCTGTGCGTGGTCGATGAAGAAT
ACGTCACTAGTCGTGAATGCCGGGTAAACATCCCAGTCGCTCCAGAGCATGAGATTGGATGCGTTGGCGAGCACACTGGCCTTGTCGCTCATCATGGTCC
ACTGCGTACGGTACGCTGACCTCAGAATCTCCATCGCTTGCTCTTCGAGAGAAGCCCACGCAGCCGTAAACGCCGACGAGGCCTCTGGATTCTCGCCACC
AACGCAGACCGTCACTGGCGGCATGACGCACTCGGCGTGGCGCACGATCAGCGCCCAAGCCTTGTCAAACATGCGCTTCATCGCAACTTGGCCGCCGAGA
TGAACTACGAACTGCACGCGCTGGTCGTCGACGACCGCGCGGCGCAGATCGCGCCACAGCGACGGCTCGCCGTACTCGAGCTCGTAGACGTCGTCGCCAC
TGACCACAGCACACTGCAGCGCACCGCCATCTGCGAGGGTCGGCGTACGGAACGATGCCACTTTAGTAGCGGCATCTTCGCGATGGATGCTGCTAAACAC
AGCGTGGTATCGCCGCCCAGGGAGAAGCGAGGCGAGGCGGAAGACCGTGGGGCGTCGCGCCGGCGTTGCGTGGTGAGCGACGCTGCACTGCGGTACTTCG
GTCCATGCGTCCGTGCGGAGATCATAGATAAGTACATGGCACGTCACTATGGCCGAGCGATCAGTCTCCAGCAGCACACGCGCTGTAGTCGCGTCCACTG
TGCCCACGACCGGCCCCAGAAGCACGCGCACGTCGTCGTTGCAGGCCAGAACATGGCCAAACACGCGGATTTCGTGGGGCTGGAGCTCCTCAATCTGCGG
GCGACGGCTCAGGGAGCGTACGGCGCGCTCCATATCCGCCAGTTGGTCGCGTAGCGTCTCCACGCGCGTCATCGCCGCGGCCTCGGCGGCGTCACTGCCG
GCATTCCCCATCTTCACTATGTTGAAAGCGTCCGCCCTGGATCCAATTACCTCTAATCTATTATATATGTAACTTCGAAACCCGATATATGTTTATACGG
TCCAGGAGTGATGGATGCTGAGACCGAACCGGACCGGTTCGGTCCGGTTCAGCCAAAGAGCTCTCTGGTTGAATGGCTCGCGGTGGCGGTCGCCTTTCGA
CACGAGGGGCCGATGACCGGCACTTCCAAACAGGTGCGTGTAATGGAGCGGTGGTGGTGATGGCGTGGCGGGCGTGTGACTCATAGATAGGGACTCTGGA
TCGATAGGTAAATCGTGCATCATGGTCGCCACCAAGCGTG