Description :
From Genome Similarity Track
Location :
Scaffold_147:5300- 11782
Sequence
6482 bases(100 bases per row)
CCACTCACTGTACCGGACTGCCGACTTACGTATAGGGTACCCCGACGTCGCGTACGGACCTTCTCTCACCTTGTGTTCCCATCGGCTGGCGGGTTGCACT
CCACAGAAGACTTGGGTGAGGACGTAGATGTTGGCCTTGAAAGAGCAAAACCCGGAGTGCCCCGAGTGCACATGCTTCACTCGGTGAGCCAGTACGACGC
CACTCAATTGACTTGGTCGAGAGTGGACTTATATAGTAATTAAATAGGGAGCTTGTCGCCCCTGGCCTTTTCTTCGGTTGTCCCAAAGGTGTTAACCACC
TGGGCTTCACTCTGCTCCCTATCTGCTAGTAGGGAGGCCGCTTCCGATAGCGAATCTTGAGGGGGGTTGCTACTCGACGAACCCACAGGCCAAAAACCAT
ATGGGGTTCTATCTGCACTTAAGTCTTACCTCGCAACTGTAATCAACGGCGGACAAAGTGTATTCCTTCCACGGAACAGGCAGGACCACTTAACAAGGTC
CTTTAAGCTTGACGAAGTCATGCCACGTAGATCGCAAATTGAGTGGTATCCTTTACCTTCTTTATGCTATCCTTGCCTATGCTGATTCCTTATTTTTATG
GCCAGGAGCTTGACATTGAGGGACCGAGGCCTACCGATGAGGGGCTGCGGTCGACCCCAAGGAGATCGAGGTCAACTGATGAGGGACCGGGCCTACCAAT
AAGGGAACGAGGTATACCCCTAGGGACCAGACTTTTCAGTGAGGGGAGGGACTGTGGTCGAGTCCGATCAGTACCGATTAATTTTTATCCTGGTAATAAT
TTCGCCTTGTTTTTACTGCAAACATTGTTTGTCCCAAGGTCGCTTCACCTCCGTGGTTCTCTTTATCTCTGGTGCCCTTTCTCTGGTGCGCGACTCCTTG
TTCCTTCAATCCACTGGACCCCAGGTCCACCACTTTTAAAAATAATTTCATAATAGCCTCCTCCTGTACTTGGTCATCCATCCAGCGGTTTGAGCACGCG
CATGTCCTGCTTTCTCTGTGTTGGGTGGTTATTGTCTAATTTATGTCTATACCCGGCTCAGACCCAACTCTCTAAGAACCATCCTCGGTCGTCATTGCGC
CTCTGGTCCACCTTCCCCCCGACTCATTCGTGCCGGCACCATCGAAGGTGATCCAGGCCGAGGCTTCCTGTGACGAATACCTGCTATTCGCTTTTGCTGC
CACCGTAGCCGTCTCGCTCGGTATTTTCTGCCACGCTAGCCACTATCGATGGTATGTACCAAGCCCTGTGTGACCTGTAGACCGGTGGCTGTGCAAGCCC
GCCGTGTTGGGGTTTACAGAGGTAGACAAGATCTTGTCTCCCTTCCGCTGCCTACTGGACAAATAAGTGTGAGCGCCTGAAGAAAAAGCTACGCCATGGA
TCAAGTCTCGTGTTTCAGACCGCGAGGGTACTCAGCACGAGATGGCGGTGGGTGAAAATCTACGGTAGTATGTCGACTACTGTCAGAGTCAATATTCTAT
CCTCGCAGCGGAGTTGGATCATGCTGACTTCTTTTGTGGGCCTCTCAAGGGTCTGGTTTACCCTCCATCGTGCATCGCGGCTGCAGGTCCACCAGTGTGG
CCGACAGAAGAAACCATCTCCCTAAAGTATCCTGCCTCGAGAGGTCGACTGCCATCCCCTATCTCCGGCTAGCGACCACGGAGAGAGTCTTGATGAGTGT
CCATCAAGTCGATCAAGTCTTTCAAGTTTGGCGCGTCAAGCACCTCGGCTTCCTCGGTTCTTAAGTCAGGAGATGCTGGCGGTACCTTCTCCCCAATTCT
GCTGTGAACCTCCGATGACTGTTGAAGCTGTGATAGCGAGGATGTCCGGGCAGCCCTGGCCATGTCGCGGTTTTCTGGTCAACGTTCCGCGTCCAGTGGT
TTTTCGGTTCCTCCGCCCCCGGCCCCCTCTTCCGCAAAAACAAAAATGGCGGGCATCAACCCCAAGCCGCTCATTAAATCGAGTCGGTCTCCGGGAAGAA
GGCCGCTCCTACGGTCGCAGGCGATGATTCAATCTAAGAAGACCGATGCTTGCTTCCTAGGATGCCATCATCCCTGAAACCTTCTCTGCCACGAAAGTGG
TGCCTTGTTTGGTCGACCTTGTCAACTCCTGGTGTGTCGGCACGATGAGCTCGATCGGCTAGGTCGACGATCTGGAGTTGCCGTGAAGTCGGTTCGGTCT
ACTGGACAGGAACGTCGACGGTCCCTACACGTGGAAGTATTCATTGATCAACCCTCTCATGATCAAGACCTAACTGGTCACCAACCCTTGGTTGTCAGCC
ACATTCCCGCTTCCACTTGTGTCCTTCCGACCGGTGGGCCATTTCGACGGTCTGGCTGCGGCCTACACACGTTTCGATCAAGACCACAGCCAAGCTCTTT
GGGAGGCAATCCACTGCTTGTAGATATCCAACGACGAAGCGCGCAAGAACACTTTCTTCGCGTCTTATTACAACGCGCTGAAGAAGCGGTGGTGCTGGAC
GATTTGGGCTGGCGGGTGGGGTGATCGACTTGATCTCTAAGGGAATGAGAGATGGCCGATTTGATCTCGACATCCCCCTGGGTCCCTTCTTTAGGCAACT
TCCTTGACCTCGCTGTGTAATTTATTGGTTTTCAGGCAGTGAGGAGGGATCATATCCAGTCGACTAGTTGGAAGCCCTTCAGGTGTTCAACCCCACCTGT
TCCTGGATCACTCAATACCGAGTGTCATCGGAGCCTTATCCTGTGACCACAGTCTATCGCATCCAAAAAAAAGTTTGATCCACCCTCTTAGTTCTCCCCT
ACTTGAATATACATGCTTCCATTCTATTTTGACGATGAATGTTTTCGTTCGCCCACATTTCCATCTTCTTGTCATACTTTCTTTTGCCTTTGTTAGCCGT
GCCTGTCATTCTTTCTTCGACGATGATGAGGCTTAACTTCTGAGGAACCAAAGTCTACCATTTAAGGAACCAAACACACGCTGCTCGTTTTCACGACTCT
TTATCACGTCTCTTAACGCTCAAAATCTCAAGTGAGGGCTCCACAATTCAGATTCATTTCATCCACACAGGAGGAATCCGCATGTCCTTCGAATGGACGA
GAAATTTTCGTTGTTGTCGCTCAGTCCGAGTCTTTTTGCCCGTACGACTTTCCAGAGTTTCTTCGACTTCATATCACCTTTCCCTAGTTCTCGCACCCAC
TATCTCCTGGCAGCAAGCATTCGTCAAAGTCGGACCTGGTTTGCTCAGTCCATCGCTCACTCGTCACTTGGTCGTCGAGAAACTCCCCGACCTTCTTGAG
ATTGGTAATATGTACGATCGGGAACAATCTATACTCTGTACCTCGTAATTCTAGGCGCGCCGCGTGATCTCCATCCAGCCCCAGAACCTAGAAAGTTCCT
AACCAAAGGTGGGCCAGTTTCTTGGCGTAACCTCCTTTAATAGATCCAGGTAAAGCAGTACTTGGGTCCCTGGTTTTAAAGTTTATGGGCGACCACTCGA
TCGTTATGTGCTTGCACTCGGGCTTGAATAGCTACCGTAGATTCTCTTTTACCTATGCTCTTGATCGCTGATAATATGTAATGGGGTGAGAACCCCTCTA
CCGTCTTACACTCTAAAGGGCGTGAGGAAGCGCTCTTATTTATAAGGTAAATATAACTCTGTTTTTATTTTGTGTTTTTATAATTCGCAATAAGTGCGAA
TATGTTCCCTTGCTTATGGGAACCACTCAAATATAAATCTATTTATTATTGACTAATTATTGGGTCTGGCACCCCAACAATAAACCAATAATAAATAGAC
GCGCAGTATCCGCTATCCGGATACTGCCTATACTTAATATATGCGATTATGTAATTTTTTTTAGGACTACCTAATATAACGGGTTGCCCCATTACATCAC
CCCCCTCTTTAAGTTGTGCTAACCGTGACGTAAGCGCCATACACAGAAAGTTCCTTCGAAACAAATAGTCCAACGAGAAGCCCAACGAGAACTCCAACGG
CATGTCATCTTGGTCTTCGAATCTGCTCAGTTGCTCACAGCTGAGTAGCATAAATCATGGACACCCACACGACGCGATTCCAAACAACAGTTGGGATCAT
CAGACGATACGAATAGAGCAGGCATCGCAGATCATGGATGACGACTTGAAGCCGTGGGGCTTGTACAGCCTCGACGGTGTTGAACAACCTGAATCACTTG
AGTCGATGAAGAACCTCTTCACACGCTATCGTACCGTGCGAGGCAAAGGAATGAATTATGCATACACTGAAGACGCACTGCAACAATCTTGGTGCGACTT
CATTAGGCGCGGGAATGCGAGTCGCCGTGAAGGAACATCCTTCACGTCCTGGATCGAGCGACGCGAAGACACTCATGGTGTACACTATTGGCGATTTACG
CCGACGTATATGTCGTCTGACCCGTATCGAGTTCCACATGTGTTACATCCATATCCGTGAAGGGTTCCCACCGTGCTTCGGGGAGAGACCGCGCCCAATA
CAGCAGGAGTGGACGACGTGGTGTGTGCATGGGGAATGCCCCAGCATATCCGACCATGGATCAGCCTCTATGAGAGGAGCCTCTTGGAGCTCCAAGTATC
TGCGCTGCGCCACATGAGAGAGCGCCCTGTCGATTAGTGGAGGCGTTCACGCAGCCGTGATCGATTGACATGCGGCCACCGTGGTCGTTCCCAGAGTCGC
TCGCGAGTGTCACGGCTCGCGGTCTTGCGGGATGATTCTACAGCGTCGGTAGCGTTCGCCGACCTCTTATTGGTCTCATACTCCTCAACGACGTCAGGAA
TATCGCGAGCCAATATACTTCGAGGCTCCCAAGTGTCGTCCGTTTGTGAATAACCCAACCAGCGGACCTTATAATGCGTCTCGGTTCGACTCTTCGATGG
CGCCGAGTCACTACTCGGCGCAAGAGGCATGGGGTCTTCATGACCGACGATACATTCCATAATCCAATGTCGCTCACACGATGCATCCACCAAGGGAGGG
GGAGCATCACGACGGAAGGTCTCTTGGTCTGGGCGCCGATTCGCATAATCGGGCGCCTGTGCCGTCGAACGACGAGCTGCGTTTTCTCCGTGCCGACACT
GGAGAGGCGATGAACGGTCTACTGAATGCCCGTGAGATGGCCAAGAGTGCTCGCGGTCGTGCGGCAGCTGCGACGGAGGCTGCCGGGATGACTCGACGGA
AGCATCAGGGGTTGATGGAGCGTCTACATCAGCTTGAGACAGCTGTGTTCGGTGTACATAAGCAGAACGAGTCTGCACGGGCTCGTGCAGGACTAGGTTC
CAGTCGTCGTCAGCGTCGTCGACAGGGGATGTCGGACTTCAAGCTGACACAGAAGAGCGGGGAAGGTTCGAAGGGAGATCCACCGGCAGGTAAGCCTTAA
GGCACCCGACATAGAACGTCGGGTGCAAACGCATAGTGGTAGGTATTTTTAGCGTGTAAGCATCTCCGTGTGCCTTAACAACCCGAAAGGGACCAATATA
TCTTGGCGCTAATTTATTAGCGCCCAAGTCCGTCACAGATGTGTCTGGTAACCCACTTGTCGATAACAAGACTCTGTCAACTTCTTTAAACGTCAATATG
TTCTTTCGACCTCTTTTGTCAGCTTTTTCCTTTTAATTATCCACTGCTTCTTGAAGGGCATCATGTACAAAACGCGTGATTCCTTGCCGTAGTAATAGGA
ATTCGGTCACAATAGCCAAACCTACAGGTGAAGTGGACTCTTTAAGAGCAAAATTAGCGACGGGAGACGCTATAGGATGCATCGCGTCGGGACTCGATAC
GCCGTTGGCCACGAAACTAACAGCATAAGTTGCATCGGTAGCAACCTTATCTTCAACGTAATCAATCATTATTTTTTTCGGCGCAATGCCATCGGCAGAT
ACTCCCCCACCAAGCTTATAAACCGGGTGTTCTGAAGCTAAAAGAGAAAGAAGCGCTCGAACGCGAGGATGCCTCGCGTTGTTCACGAAAAATGGCATCA
ACCCTGTTGGCGCATGAACTGCATTGTTGATTGCATTCAGCGAGTGGAAGAAATGAACTCCACGACGTAAACGATGTCGCATATCTGCGCAGGACATCTT
CAAGCGCTCTGTTCACGCGGTCCGTTTGCCCATCCGTCTCTGGATGGGTTGCCGTAGACATAAGCAATCGCGTGCCAAATAGTTGAAGCAACTCTGCCCA
AAAATCCGACGTGAAACGCGGATCACGGTCCGAAACAATGGATCCTGGCAAGCCTTGGTGCCTGAATATAAGATCGAGAAAGATCTTCGCGATCATCCCC
GCCGTAACGTGCGCGGAGACTGGAGAAAAATGCACAATTTTGCTATATCGATCCACAAGAACCAGTACGCCCGTGCGTTTCTGTTCATCCGGCGGAAGAT
CAAATATGAAATCCATGCTGACCGAATGCCAGGAATCCGTGGCAATCGAGAGCGGTCGCAATGGGGCTTTTGGAGACGGCGC