Description :
From Genome Similarity Track
Location :
Scaffold_431:530- 2551
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_431-fgenesh-gene-0.0B9 protein
Pytar_ATCC12531maker-par_contig_431-snap-gene-0.14Choline-phosphate cytidylyltransferase B

Sequence
2021 bases(100 bases per row)
AGTATCCGGGGGTTGGTAATCTCTACTGCCGGTACACAATCACGTACGGCACCGACTGGCGAGTCATCCATGTGAGTGTGGGAGATGGACTTTGAATCGC
TCCACACACTTCTTCGTCTAACGCTCACGAGTATCAGGGCGCGGACGCGGGACTCACGCAGCTTGCGTACCGCTCGTCGCACGACGGGACGATCGTCTTC
AATTTCCCAGTCGATATCTCCTTCAAGAGTACCAATCCGTTTGGCTGGCCGCGGATCGTGTTCAGCGTCTACGGACTCGATGGCATGGGTCGCGATATCG
TCAAGGGCTACGGGTCCATGCACATTCCGACCTGCGGCGGCACGACTCGACGGCAGGTGCCGCTCTTCAAGCCACAGTCTTCGTCTCTCCTCCAGCAAGT
CTCTGCCTGGCTAACTGGAACGCCTCCCGAGGTAGCTATGATTCTGATCTCGCCACACAATGAACCCGACACCTCAATTAACACCGTCTTCCATGCAGTA
CTTCGACGCGAAATTCGTGACACAGAACGACGGGCGAGAAGTAACGCGTGTGACGTCAGCGGGCAAGATTAACGTCTCGCTCAACGTCGTCACGATCGGC
ATGAGGCAGCACGGGTACAGCAGCGAAGCAGCCTACGCATAACTCGTCCCGCAAGTTAAAATATCGAAAAGCCCTTCCGTCCGCAATGTATATACCCTCC
TCGAAGCTGGTATTTGGTTGTCTTTAAAAACCCGCCGACCTCTGCTCCTGCTGCTCGAGACGAGTCTGGCATCGTGCAAAAAATGTATACAGTTGTTCTC
TCTCTCTCTCTCTCTCTCTATTAGATATGGACTCTCTCTTTCTCTCTCTCTCTCTCTCTCTCGCGTTGGACAGACCCAGTCCCCGATACTCTCTCTCTCT
CTCTCTCTTCCTATCTCCGCCTCAGCTGTTAACGCCCGTTCCCTATGGACGTACAGGCGATGCACGCAGCGACGCCGTCGCGTATCACGAGCACGACCTC
GTTGTGACGGTGGCGTTAAGCCGTCGGTCTCTAGCACAATCCCTCACGGGCAACTTCCGACAAACGCTCCGAGAGGCGCTCCTTGATAATCTTTCGGCGC
TTGCGGAAAGTCGTGCGCTGTTACAATACCAATCGCCATCAGATTATACGCCACTACCAAATAGCCAACTCCATATCGTAAACGTACCAGTCGGCCCTCC
TTGCTGAAGAGGTCCAAGAAGCCGTGCTGCATGTCTTCCGCTTTTTCCATCCACTTGTGGACCAACGAGTCGACGTCGTGCTTGACCTTGTCGACGGCCA
TGTCAAACTTGATGCTCTGCTCCTTCATGAACGGCACATTCATCTCCTTGCCCGTGTACCCACGCTGCAAGTTGCGGCGAATGAACGTGTCGTACTCGGC
AATGATACGAATGATCATCTCGGACGTTGAGATGCCCTCGGTACGCTTCGTCTCGAGAAACTTGCCCATTTCCTTGATGCGTGCGTACACATCACCTTCC
TCGGACGTGCCCGACGCATCCGTGTAAGGCAACGCGTCGTGGCACACGTAATCGATCTGGTGCTTTTCCAAAAAGTCGTCCGTGATGACCCACGGCGCGT
CCTCGACAACTTCGTCGACCCATCGGCAGTGGCGCAGGGACTCGTACCGCTCCTTGTCAGTCATGACCGTGCGGCCCTTGAGCTTGTGGGTGAGCTCGTC
ACTGCAGCAGCCCACAATGAGGTGCGTATTCGGGTAGGCCTCCTTGCACTGCTGGAGCGCCTTGGCGTGGCCAAAGTGGAAGAGATCGAAAATACCATCG
GCGTACAGACGCAGCGGGCGGCCCGTGAGCGTGCCCGGCTCGCCTTCTTTCAGATCCCGCCGGAACGGATGGTATTCGCCGTGCTCATCGGTCGTGCCGG
GCTTGTACTCATACGTGGCTGGCTCAAGAGGCTCGCGAACCTCCTTTTCCTCTTCAGCGGCGCGCGCCTGCTGCTGCGCGACCACAGCCTTGACCGCTTC
CGCCATCATCAACTTGGAGGC