Description :
From Genome Similarity Track
Location :
Scaffold_3472:530- 2211
Sequence
1681 bases(100 bases per row)
GAAATGATCCACGGTTTCCCGGCATTACTTGGATCCCACCTTCTTAGATTTTTCAATCTGACGGGGAAGGTAGACCGGCCACATTTAGTCGATGTAGGTA
TTCTAGCGGGGATTCATCCTATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAA
TCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTTGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCG
ACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCGTCTTGATCCTTGCCCGTGAGCTCTTTCAGATCCGATAT
TGGCTGAGAATCCCTTAACCCTCTGGGATCATGGACGATCCACCTGCCCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTC
GAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCCCGGGCGCTCTCATA
CATTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGAAAGTGTTGGAAGAGCCTGTGGCCGTCTGGTTCACTGGCG
AGACCGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAATCCCACTGGATTCTTGTCGGATCTGGCTCGATCGTGGCTGGATTGTGTCAGATC
ACGCGTAGGGCCTACTGGATCCCGAGCCTTCGCGCTCACAGGGACTTCCTGTCCTCGGCTCCTCGCCCGCGCTTCCAGCATGGATGCCCCAGAGGGTCCT
AAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGATGCAGCTTGGCTGACCCTCGGCGACGACACCG
GATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATTCAGGTCTAGCTCGAAGATATC
CTCTGCGTCGAACGCACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTTGTTGGTGCTCTT
ACCGGTTCCCTTGGATCGTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACT
CGAGATCTTGTCCGACCCAGCTTGACTGGGTTCCCAGCTTGGTCTTCTTCCCGACTCTGGAGCTTGCATCCTCCTTCCCGCGTAGTCTTACTCGTGTTCG
TCTTCTCTCTCGTTTTTGCTACTATCGGGCTTGGGCTTAGGTACGGTGTTGGATTAACCGGTGAATCTGCAAATACATACCGTCTCACCTTCACTTTCCC
TTATTTTGTTAGCGGATCATGATTTGTGCCAAGACCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCACTTCTAGATCCGGATCCACC
TCTCTACCGTCGACAGAGTTCCTCACAGGACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGATGATACA