Description :
From Genome Similarity Track
Location :
Scaffold_1238:53- 2921
Transcript NameFunction/comments
Phyke_g11696lysosomal alpha-mannosidase, putative

Sequence
2868 bases(100 bases per row)
CTCCACATCCGCATCGACAAAAGACTTGCCGAAGCACAAGCGGAACGCACGCACTTCGATCGCTTGCAACACCACACTCGTGCCCTTCACCGGTAGACTG
CGTGGCGACGCACCGTTCGACTCGTCCGTCGTCTTCCATAAGAAACGACTCGATTcagctgatgatgacggcAACGGCTTCGTGCCAGTCAGCGTCAACT
CCGTCACCTCTGACACCACCGCGTTCTTCACCGTGAACAGCTTTGAGAAGTCCACCGTTGCAGGCTGTGACAACGTCGCGTGCTCGTCCACGGCGTACAA
GTGCGACAGACGCACCATCAGACACTGCTTCGATAATTCCTGCATTGTCGTCAGACCGACATTCGGCGGGAAATCGTTCACTGTCAGCCACGGGAGCTTT
GCCTGCTCATCAGCTGACGTAACGGCCTTGCGGAATACCGTCAGAGGACGGAAGAACTGCGACTCCATCTTCGACCGCAGACTGCGCATGCCATCCTCCG
CAGAGTCCACGTTGATGAAAAAGTTACCGCGGACCACCAGACCCTTCGTCACTTGGGTCTTGGTTGCCGAATCGTACACGGACTCTGTCTCATTCAGGTG
TTCACCCACACCCTTTCCATCATCGTCCAAAAGACGACGGTGCACCATCACCTCTAACTGGCCATCCGCCAGACTAGCTGCACCCTGCGCGCGGTCCGTC
ACAAGGTTCAACTGACGGTTCGTGTCCTTGATGTAGGCGCCAGTAGTGATAGGGAAGTAATTGGCCGCCACTGCGTCTTGGTTGTTATGCAGAGTCAGGT
TCCACGTATCGCGGTGGTTCCGCACACGTTCCATAAACTCCAGCGCGTTCGAATCCGTGTATATCTTGCTGGCCGACTTGATGTTGTCTCCCGCATCAAG
ACGGAGAATTACTTCCTTGCCCTTGTTGTCCTTGATCGGAATCGATCCCACCGTCCATTCGATTTCGAGgaactcgtcgtcctcattcACGCGGTACTCC
AACGTCACCCAGCTACCGATCTTGAACGCCACGCGAGGTACGCTATTACTGTCAGTAGAGTCGCCAGTCTGCAGATCGATCATCTTCACGTCAGGCAATG
AACCCGTTGGAATGCCATCGGATGTCGCATTAGTCACCGGGTAAGTCTTGTTTGAGTCAGGGCGGAAGAGATATGCGCCAGAGTGCGCTCCATTGCCACC
CTGGAAAGCCTGGTAATATGCCACGTCCAGCGACAGCGGAATCTGaatgttcttcttcttgttggccagCTTGGTGATCGACCCCGTCGCCTTGTTGATC
TCTGCGCGGATCAGATGGTTCTCCAACACAACAACTTCGTTGCCCTCACTATCGTCAATAGGAGCCACGTCGGTAGTACTGTGCAAAAtatcatcaacat
caactcCATCTGTGGTCTTTTGCTTCACCAGCAAACGCACCGTACTCAAAGGCTTAAGCTCCACGCTAAACACGAACGAGTACGGAGCCACCTGCGTCTC
CGGATGCACTGGCAAAGCCACAAACACATCCTGACTTCGCACAGTCGCGTCGCcagtcaccacttgcacCTCAGCAGTCTTGTGCGTGATCGGAATGGAG
ATGGTCTCCACACTCGTGCGAGCAAGCGCGTTGTGGATCAGTACGTCGAATTCATCGTTCTGCGTGGACACGTCACACACACTCGTGTTGGCCATGAGGC
AGAAGCGGAAAGGCTCTTTCTCGCCAATCACGAACAGCACCTCattcatctccttctcggcGTCGATGATACCATCGTTTAGTCGGAGCGCATAGTCGTA
TGCCACACTTTGCTTCTCCGTTCCCGACAGGCCGTCATGATGCTGCACGAGACCCACAGCACGTTGTAGGCTCACCAGCTCAGTCGAGTGGTGGCTCTGG
TACACTGCATCCAGCTGTCGCACTTGTTGCAGTAAGATATTGGCAACCCGTGCAAATCGCTTCAAGGTCGGCCGACTCGTGAAGAAACCCGACCAGTAGT
CGTGATCAGCTGACGCATACGGCATGAAGTCGTCCGTCTTGACGCTCCACGTAAGTCCTTCCGCTCTCTTCATGTCTGTGTAATAAGACAGGTTTGAGTA
CAGCACATTCAGACGGTCATCTTGGTTCACGTAGTGGATCAGCTTATCCATGTTCTTGAACCACCTCAGGGAGTTATCGTATTGGAAGTCGCAACCCATG
GGGATGAACACATGGTGTCCTTTAGTGGCTGACCCACGCATTTGAGCAGTTTTCACAAACTGATCGACTTCGCCACACACATCGTAGTCATGTAGATCAG
CATCATCCTGGATCTCATTGCCAATGTTGCCGTACTGAAATGTCCTTGGAGGACAGTACGTGTCTATGATCTCTCCAGTAAACACCTGAGACTCCTTGCC
TCGAGACTTGCTGGGACGCCAAATGAACTCTAAATCCTTCGTTCTTATACGCTGTCCATAGTCCTGATAGTCGATACGTGCAAAATACAGCGCATCGAAG
CCCACGCCTTGAGACAACAATGATCCTTGTGTGGCTGAATGTCCGAACGGGTCAATCTGCCACCCGATACGAGGACTGATACCGAACTCATCCATCAATA
ATTGATGGCCGTAGGCTGTCTGGTCCACCATTGCAATGTAGTGTGGTGTGGCCTCGTCATGCATGCACCAGCCTCCATTGACAGTGAGATCCAGGCGTCC
TTCCTTCACCAACTGCTTCACAATGCCGCGTACTTCTGAGCCTTGTTGGTGCCACCACCGTTGGAAGAATGATTGCTCCACGAACATGAACTGGCGGTCT
GGATTGCGCACGAGTTCCTCGACTGCAGTGTCCAAGATGTActgcaccttctccatgtAGTACTGGTC