Description :
From Genome Similarity Track
Location :
Scaffold_365:53- 2074
Sequence
2021 bases(100 bases per row)
TGTTCATTTAAGTTAGGACATACACGTAAACGCAACCCACACTTTGTCTTCGAGCTGGTTCGACGACCGGATGCGATGGTGTCATCCCCGCGCACATCCC
ATCCACACCTTCCTTATATATGCAGGGTAACCCCATTCGGCAAAACTTGTATAGCAACCGCAAAGCCATTAGCAGATGCATACGCGTGAGCCGCTTCCTT
TGCTCAATCTGGATTGTTATCTGCTGGAAGAGGGTTCGAGGGAGACCAACAAGAGTCACTCATCGTGGTCGATTAAGGGATAAGTTTCCAAAGCGGTGTG
TGTGGAAGCAAGAATGTACGGAAATCGCGAATCGATTGCGATATAGTATACTCATTAAGAGAAGTGTAGGAAGATAGTATGTTTTAGGAGGCCGTTCACA
CACTTGTAGGCAATCCGATTCTTCTGTGGCTATCACTTATTTTGTGGCCATCCACTAACTCGCGGCTATCGACTCGTTTTTAGGTGAGTTGCTTGTATTT
TTAGGATCCCCCTGCAAAATATCGCTATGTGTACCTTACACGTCGTACTAAGTGCGGTGTAGCATCTTTCATTGGTCAATAGACATTATACGTGGCACAC
TCTTTGATCGGGTTACGAATTGCGACTGCGAGCTGTGTAACGTTTTTAAACGCACAAATGCCCGCACGTAATTGGCTAAAAAGTGTTGGTGGGCGGGTAG
AAAGCTAACAAGTAAATCCTAGACGCATAGGGACAGCGAAAGTATCACGTCTTTCGCAAACAGTATTTTCAAGTGGTTTACCTCTTAGGTATTTGATATA
CTGATATAATAAAACGATATGGTCACAATTTTTTTCTAGGTACTAGATCGAGCTTTTTCAGCAAAATCTATCTTGAGTATTAGTTTGTTATGCTTCGTAG
GCCGCACTTTGCTGTTTACGGTGTTGCCGAGCAGTATCATCTTCGTTTTTCTTTTTTCATATTCGTCTGTTTAATACAATCAACAGCGCCAACAAACATC
TTTAAAACAATCCATCTTCACTCTTATTGACAAGCACACACACCACAACCCATTTCCTCGTCGCCAACCTCCTAGAATGGGTACATATATATACAGAACT
TTATTAAGTTCTATGGAATGAATTACTCATACAGAAGAGCAAGCTCCAAAGCTTGCTACCCTATCTTAAGTTGGTGGTGGTAACGACTTGCCGCCATTGA
GCACGGATCATGTACAAGCACAATATCAGCCGTCTCTACCACTTCCAGAAGGCGTACTTAATGCATTGCCAGCGCATACCTCAGAAAAGTTGTTATCCCA
CAAGTTCTAGAATAGACCCAAGATTAGATCATTCAGGGCAAACTATACGTCATCTATAATCTCAATTCGGGAACCGACTACCGTGGCGATAGTAGAATCT
AGTTCTCACTGACAGCTCCTCTAACATATTACAAAAAGGGTGTGTTCGAAGTAAATGCGGTATTACGTGCTACAAGAACGTGATATTGAAATTAAACTTG
GTGGCATATGCTTGTCATACGCAGGCGTGGTAAACATATCTTGGAACGGATAAATATAACGAAGGATATCATTTTTTATCAGCAACCAATTGCAGTCGGT
GCTAACCTATTGGCTTAATGTGTACAGTACGTTACCCTTTCCGGCAAGGCTCTGTTCGACAGTTTGGTCAACCTAACATTTAACGAAGATAGTATTGAAT
GATTTAATCGTGGTTGCTCCATGAACTTGATACAGAATAACAGCATTTACGAAAATCGCCTCTGACGCTTGCAAGCTGAACCGCTTGAAGGAGATAATGA
TGTCTTGAAATAGTTTAAAGTGTCGTGTCACTAATTTTATCACTATCATAGATCGGTAAATTCATGCAGATGCTGCGATTTTGGGTGTTCAGCCTGGTGT
GTTCCAGTCCATACTAATAAATCTTGAGCGATAATACTTGCAACTTATACCAATGTATATAGGTAATTTTACAGATATAATAGCTTCGAGAGCTCACCAC
CGTAATTTTTGTGGTACTTGG