Description :
From Genome Similarity Track
Location :
Scaffold_2932:53- 1834
Sequence
1781 bases(100 bases per row)
GAACCAGAATAGTGTACCCATAATAGGGTGACCATGATGATTACGTCATGGATCCGGTGGATCTGAAGATAACACAGCTGGGATGATGGGTCAAGGGAAG
AAGGGACATGCAGCCGAGCCTGGTAAGGGATTTAGCAGATGAAAGACATAGAAGGTAGAAATTCAGGCAGGTATAGGCTGAAATATAAATAAAGAACATA
ATTTGCACAGTATCACGCAAGTGCCTTCCTGCCCTCAAGAACCGGAACTACATTTGGCCGTACGAGCTCGGAGAAGGTTGGAAATTGCGAATCTAGTGTT
GGTAGTGATAACTGGATAATACATTGGCCAGATCCTACAACCTAGTGAGCTTTTCCTTTACTTGTGCAGATCCGACAGGTTAACCGAATACACTACTTGG
TCGGTTACACCTTAGAGGTTCTCAACGCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAAACGCAAAGGCAAGGGAGCACACCCGCAAG
GCAACCCTACGGCCAGATCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACCATCCACGGACGCAGAGTGAAGATTTTC
CACTGCTGCTCCACCCCATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGTTCCCGCCCTACCG
ACGGGTACATAAGGTGAGAAAAGTTTAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTAGGCGCAGTTGGTAAGTTGGATCTGGCA
ATCTCGCAGATTTTGCTGATCCCGCTACACCACATCATCGTCCCGATATGTCATGCGTATCCGATCATATAGATCCGTTGTCACCCGTGTGATGTGGGCC
AACTCGTAGTCTGGACGCCGAGAAAGGGCGTCGGCAAGCACGTTAAGCTTGCCCGACTTGTACTCGACGCGGAAGTTGTACTCCATCAAGAAGGACGGCC
ACCTCGCCATCCTTTGGGAGAGGTGAGGCAAGCTAGTCGCCGTCCTCAAGGATGCGTGGTCTGTGTAGATCACGAAGGCCTCGAGCCCAGAAAGTGAACA
CGAAACTTCACAAGGGCATATTTCATTGCCAGGAGCTCCTTGTCGTGGACAGAGTAGCTCCGTTCGGCGGCTCTGAGCTGCCTGGACTGGAACGAGATGA
CTCATTCGTGTCCAGCCGTGTCGCCCTGCAGTAATGCACACTCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGGCTTCGTCTCGTCCGGCAG
GGCCAGGTCAGGGGCCTCTTGGAGACTGGCCTTGATGCTATCAAAAGCATCCTGGTGCTCTTGCTCCCAGCACCAGTCGACGTCCTTCTGAAGGAGGCCC
AACAAGGGCTTAGCGAAGCCCGCGTACCCTGCACTGTACTTGTGAGGATAGTTGGCGAAGCCCAACCACTTTCGGAGATCCTTCTGGGATCGGGGGTCGG
CCATGCTGCGATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCCACGTTGCTTACGAAGCAATCGAGAACTTTAATTTCTGGTGACGCAAAAACGCAC
TTGTCGATCTTGGCGTAGAGCTTGCTCGCTCGCATCACGTCCAACACTCGACGGAGGTGTCCTAGATGCACCTCCATAATGGCCGTTTTGCCTCTCTCGG
CACGGCTATGGACGAATATGTCGTCGAAGTACGTCTGTACGAAGGTACGCAAAGGGCGGAACAATTGCGTTACCAGGCGAT