Description :
From Genome Similarity Track
Location :
Scaffold_1015:53- 1439
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1015-snap-gene-0.3Serine protease family S10

Sequence
1386 bases(100 bases per row)
CTAAGCACGACATTGGCTACGTCAAGCTCCGGAACAAGGTAGACGCGCACTATTTCTACTGGTACTTTGAGNNNNNNNNNNAGCGCACACCCGGAGAAGG
ATCCACTCCTGTTGTGGCTCTCGGGTGGAGGCTCGAGTATCTTTGCGGCGCTGTCAGAGAACGGTCCGTGCACGGTGCGCTCGGATCTGAGCACGCAGCC
GAATCCGTACGCGTGGAACACGAATGCGAATGTGCTCTGGATTGACCAACCAGTGGGTCAGGGCTTCTCATATGGTGCTGACGTTGATACCGACCGCACG
GCTGAGGACGCGGCGGAGAATCTGTACGCGTTCCTGCAAGTCTTCCTGACCGAAAACCACCCGGAGCTCCTCGAGCGCGAGTTCTTCGTCGCAGGAGAGA
GCTATGCGGGCCACTATGTTCCGCTCGCAGCACGCTACATCGTGGACAAGAACAAAGCCATCAAGGCGGCTGTGACAAACACCACTAGTGGCAGCAACAG
CACGAACGTGCGGATCAACTTGCAAGGCATCGCGCTTGGCAACGGGATGGTGAATCCAGTCATCCAGGTACGCTTTGCATTTTGCTTGTACCATGTCGTT
TACGTATGAAAATGTCATCTTAACTCTCGCTTGTTTGCATTCTTTTTGTCACGGTGTAATGAATAGTACGCTTACACGGCCGATATGGCCGATAATGCAT
ACAACATCACAGTTTTGTCCGATGCTGAGCGCATGGCGATGAAAGAAGGCAGTAAGGAGTGCATCCAGTTGACGCAGGCATGCGAAGACACAGCGACGAC
GTGTCCCGAAGCACAAAGTTGTTGGAATTCGACGTTGTACGCGCCATTTTGGGCATCCAAGCGCAATGTGTACGACATCCGCCAAGAGTGCGTCGTCACG
ACGATGTGTTACGACTTTTCGCCTGTGATCGAGTTCCTCAATTCAGATCGTGTGTACGAGTACATGGGCGTCGACCGTGTCAAGGTACCGGTCTGGGAGG
TCATGAACTTGACGCTCACACAGATTTTTTCCGAAAGCGGTGACTGGTCCATGCGGTCTGACCAGCACGTCGCGGTGCTGCTCGATGCAGGTCTTCGCGT
GCTCGTGTACGCGGGTGACGCCGATCTCATGTGCAACTGGCTGGGTAACCAAGCGTGGACTAATGCGCTCAAGTGGAAGGGCAAAGCAAGCTTCAATGCG
GCAACACAGCGTCCTTTCCTCACGAAAAATCCACTTTCAGGCGTGGAAACCATTGGCGGCGAACTCAAGACATTTGACAACCTGGCGTTCCTGCGCGTGT
ACAATTCGGGGCACATGGTGCCTATGGACCAGCCGGGGCTTGCGCTCGATATGATCACGCGCTTCTTGAACAACGAGCAACTTTAG