Description :
From Genome Similarity Track
Location :
Scaffold_424:53- 1057
Transcript NameFunction/comments
Physo_125823reverse transcriptase

Sequence
1004 bases(100 bases per row)
GTGGACCTTGCGTCCCATCCGTGCACCAAGTAAAAAGGGGTGTCCTTCCTCATGGTGTCCTGCGAGTTGTTAATCGCGAAGATCAACTTCTCCACAATTT
CATCCCAGTCTTGTTGCAGCGGGTGCTCCGCGTACACTCGCACCGATTGCATTACGGTCTTGACCGAGCGTTCTTGCTGGCCGTTAGCCTGCGGCCGATA
GCTCAACGTAGCCCTAGATCTCGACTGCATCATCTCGGCGAAGGTTTGGAAGACCTCGCTCATGAAGCGCGGGTCTCGGTCATGCCTGATCAGCGTCGGC
GCTCCGAACCTTCGGTACACGCACTCTTCGAATGCTTGTGCTACACAGAGTGCAGATGTGTCCGCCATCGCCTTGCCCATGACGAATCCAGTGAACGCGC
ACTGAAACAGTAACAGTGCGGTATTGCCCCGCCGAGTCTTCGGTAGGGTATCACAAAATCCATCGAGACAATTTGTAGCGGGCGCTCGGCCAAGATGTTG
CCCGGCGAGTACCCACGTAGTTGCGGGCGACTCTTGCTTGAGCTACAGTCCGGGCACGAACGTACGTGCTTCTCCACGTCGGCGAATAAGCCAATCCAAT
AGTAGTCAGCCTTGACCCGGTGGTAGGTTCGGACGATACCTTGGTGACCGCCCTCCAACGAGTCGTGACAGTTCTGTAGGATCTCCTGAACCATCGTTGT
TGGCACCACTAGACGTAGTGTCGTCTCCTCGGCCCGGTCGCGACCCCACCGACGGTTCGCACCAAGGAAATACAGCAAGCCATCTTCGCTTAACACGAAC
TTGTCAGCCATCTTCCAGGCTTCGCGTGCAGCTTTGTAGGCAAGTTTCGCTTCTTCTCCCTTTAGCACCGTCTTGAGGTTTGACCATCGGAGCTCCTCAT
CCTGGGCTGTGCCAATGCGCCTGCGCCGTTCTTCCTGCACCACTAGTGGGTCGATGTCGTCAGCACTCGGTTCATGGACCACCGTTGCGTCAGGTCTCGG
TTGG