Description :
From Genome Similarity Track
Location :
Scaffold_322:5299- 12313
Transcript NameFunction/comments
Phyag_g4650family 3 putative glycosyl hydrolase
Phyag_g4651acetolactate synthase small subunit, putative
Phyag_g4652conserved hypothetical protein

Sequence
7014 bases(100 bases per row)
CCGACGCCCAACGGCGCGGTCTTATCACGACCAGGATCCCATGGTACATGTAAGCCAGCCTAGCTTACTCAACGTGGCCTAGTCTTGAACTTACCACGAT
GATGAACGGCGCCCAAAAGCGATCTATTATAGCACTCGTATGAGCGCGGCAATGGCTCAGTCGTGGACTCTCTCCTCGTGAAGATAAGAAGCCGTGCGAG
ATCAAGTCGTTTCTCTGGTGGCAAGACGCTATGCTACGTATTTGTGCGACAACATCGCTGTCGACATTGGATCGCTTTCCTGGACACACTACGGCACCAC
ATAGAACGAAGCACTGGGCGTGGTCAAGGTTGTGCCCTGCACTCCTGAGTCGCTCAGCGGCAAGCTACTCGGGCCACCGCGGTTTCTAGTTTGGATGGAC
TTTTCACCGCTCTCGTCCAAAGAATGGGGCGCTTGCATCATCGAGTTGTCTGTGGAAGATGGTAGCAGCGACACGATAAACTCACCGGGTTCAGCCTGCC
GTTGAAAGCCGCTACCGACAACATGCGGCTCGTAGTAGCTCCAATCCTGCGGTGTAAGCACGAAATCGACATCCACACTGGCACCCGGTGCCACCTCGCC
AAGCTTCTTGAACGCTTTGAGCAGCCTGGTTTCAGGTACGGATGTACGCCGGAACTTTTGAgcaacaaacagcagcacgacttCTTTGCCCGGTCGAGTC
CCTCGGTTTGTCACGGTGAAACTAACCTTCAATGCTCCTGTCGTAACGTGTACCTGGGTGGTGTTGAGGCGTAATGCAGAGTACTCAAACTTGGAATAGC
TGAGTCCATGGCCGAATTGCCACTGCACCGGACACTCGTCGAATGGCTGGCATCGTGTGTTAACACGGTGGAAGTATGGCAGTAGTTGCGTGCTGCGAGC
TGGATATGTAATGGGCAGACGTGCTGACGGGTTGACGTCGCCAAAAATCACGTCTGCTAACGCTTGACCACCCTGTTCGCATGGTAGCATGCTCAAGAGA
ACGGCGTCGGCATTGTTGTGGGCCCCCTCAAGCAAACGAGGACGGCCGGAGACCAACATAACAATAACCTTGGTCGAGTTGAGCTTGGTCAGCTCTTCAA
GGTACCACAACTGACCGGCAGGCAAAGCCATACTCCCAAGCAAATCACCGGTCTTCTCCGCGTAGTTCGGTTCGCCCAATACAACCAGAGTGTATTTACT
CTTGGCAGCAAGCTGTAGTCCCCGCTGGAAATCCTGAGGGTTAATCTTGCCATCAATATCAACCACCTCAAGATGTTCGACCTTTGTCTGTCTGCCCGAC
GAGGCTGCCTTCGCTTGCACCGCCTCTTTGAAAGTAGCTCCGTTCGGAAAGAGTGTTGAATCACTGGATCCTTGCCAGAACACAGACCACCCACCGCACT
GGAATCCTTTGTTGTCTGAAACGGGTCCAGTGACAAACACGCTTGTCGTTTTCTTCAAGTCAATTGGTAGAGCGCTGTTGTGGTTCTCAAGTAAAATGAC
GGACTCTTGAGCCAACTGCAACGCATCCTGCTGGTCTTCAGAACTCCCGATGTCAGAATCACGGTCCGTACTATCCTGCACGAATTCATCGTAATAGTTC
GAGTCCAGCAACCCGAGATCTCGTTTGGTTTCCAGAATCCGTCGCACCGATTCATCAAGGCGGTTCTCCGAAATGTGTCCGTCCGTTACCAATGACTCTA
TCGTGTTTCCGAAAGCCTGCAAGTCTGGTGACATGTTCATATCAAGAGAGGTCTCTTGCAGAGTAACTCGGACAGCATCAGCCACGCTGGGCACTAAATG
GTGCTCCGCGTACATGCGATCCACTTCACTATAATCCGAGACCAATAGGCCCGTGAAATTCATATCGTGCCGCAGTAAATCAACGAGTAGATTTTTACTG
GCAATCACGGGGACGCCATTCACCGACACATAACTCTCCATCGCCGTGCGTACACCCGCACGAACCGCAGCGAGGAACGACGGCGAATAATAATTGACCA
GTTCCCAGTCCGTGATCACATTATCCGCTCGATCAAGTCCTTCACGGACGTTTGAGTATCCAATAAAATGCTTCATACAAGCGGCCACTTTGCCCGAGCT
CTGTAGTCCTTTGATCAATGCTGCGCCCATGACAGACGACACCAACGGATCTTCTCCGAAAGTCTCATACACTCGAGACCATTTCGGCTGCACTGCAATA
CCCAGCACAGGACTAAAGATCCACGGGATACCTGCACTCAGCGTGTcttttgcagcaacagcacccaTGCGGTACACCAACTCGGGGTTgaaagatgcag
cagcactaaTAGGCTGTCCAAATAACGTAGCCCCCTGAACGTACGTAGCACCGTGAATAGTATCCACCCCATACAACATGggcactgcagctccttcctc
TTTGTAGATCTCATGGATCTGGCCTATCACGTCGCGCCATtcgctcgcgctccagcCTGTACGTCCGCCCACTGGCCCCCCAGCGAATGGACTATTGAGG
ATCGATCCCACACCTGCCCGAGCGTATTTAGCCACCACATCTCGCCTCAGAGCCTTCTTTGGGTCTcgctcgtcgccgtccatcATGGAGTAAATGTCCA
TCTGCGTCATCTGCGCCGATTTCTGCCGGATCGTCATGTTGGATAGCAGAGCATCGATGTCGACGTCACTTGGAGCGTCTGAACGCTCTACGCGGCTTCG
GAGAGCAGCGAAAACGGCCGTATCAGGGTCATACACGAGTTCGTGAGCATTAGAGGCcgctgcagcggcgacagAGGGCGCCCATGAGCTGCTACAGACG
CAACAGAGCAGTGTCCACAAGAACGATCTCTTGATCTCCATGCTTATTTTCTGGTAATGCGTAAGAGCAGGTCATAGATACGTACCGTAGTTTGTGAAGA
AGTTACACATGCAAAGGTGAAGATAGCAACGTACCTTTGCAACTCTGaatttgttgctggtgtgtTTGCGCAGCCACTGCACATTCCAAAACCCGACGTA
GAACTTGGGACCACGAGCTCAGACGCCACATTCGACATTCGTCAAGATGCTGAGGAGATCCGTGCTGCCGATTGCGCGTCGCGCCTTCCCACGGTCCGGG
GCCGCCATCGCGCCGTCCTGCGCCGCCCCCAAGAGCTTCTCGCGCGCCTTCAGCGTGGCGGAGCAGAGCCAGCGCCACGTGATCGCCGCGCTGGTGGTGA
ACCAGCCTGGCTGTCTGGCCGAGATCGCCAACCTCTTCGCCGCTCGAGGCTACAACATCGACAGTCTGGTGGTGGGCCGcacggaggtggaggagctctc
CCGCATGACGGTCGTTGTCAATGGCACTGCGCAGAGCGTCGTCAACGTACGTTCGCAGTTGATGTAGGAAAAGGTAGAGAGATGGTGTAGTTGTTGATGT
TTGTTTTGGTTTGTTGATACCgttgcagatgaagaagcagctggaggacgtcgtGTACGTGGCTGTGGTCAACATCCTCAGCAGTGGCAAGAACGCCGAG
AAGAACTACGTCGAGCGCGACCtgatgctggccaaggtgtCCACAGCCGGTACgttggagctgaagactTATTAGACCACCGGAATATGTATTGACGTTG
CTGTGGTGCAGAGGCTGGATCCCGTGCtgaggtggtggagttggCTAACCTGTTCGACGCCAAGGTGATCGACGTGCGGCCGCACCAGGTCATGGTGCAG
CTTGCTGGCACTCCTGGCCGTATTGAGGCCTTCCTGGACCTGCTGAAGCCGCTGGGCATCACGGAGATCCACCGCAGCGGCGTCATTGCTATGGctcgca
gcaccagcgtgaCCGACACGCTGGGCGACCTGTCGACCTTCGAGGGCGCTACTCGCACGCTTTTGGACGAGGCTGACGACGTAGAGATCGACGTCTCCCG
CCTCCCTCCTGGATAAGCGGATAAGGAGATATCGGTAGCGTCTACGGTCTCGCGATCGCtatttttcttcttggtagGTTGCATACGGAAGTGCGGACTG
GAGCTGGCATGTTGTCAAGCTGTGGAGCAAACATGCTAGTGTAGTTTGAGGGGTAAGAGGAAGTCTACCTCGGTAACTACTTGTAACCAAAATCAACGTT
CCTGCCAGAAAGTATTGTTGGTCGTCGATGCCCAGCATGCGTCAAATGAATGTTTTGCTGATTCATTAGGCTCAATTTCGGCCTTCACATTCAGGATCGC
GGCAGCGCCGGTAGGTGCAGCGCAATTGTGTGATAGTATCCAGGTAGCGCGGTCTGAGCAGGCAAACAGTTCACACATCCGAATACTTCACCCCATTCTT
CTCGAAGTAGAAGCAACAGGGTCGTTAAAGGCGTCCGAGATAGCCTCTAGAGCCAATAGTGAGGCCTGCTGCTCCGATTGAATGACAGACTCGAGGTTAC
CAATCTGAGCTTCAACTCGCGCGATGCGTTCTTCTAGTCGGCGGCCGTCTGAGCTAACACTCTCGGTGAATTGTTGCAGTACTCCTTCTTGGTTGGAATC
GAATTCGCGCTTGAATTGCGTCAAGTGTGCTGATACTGCGTTCACGACGGCATGGGGGTCTGTAGGAGTCGCATTCGCTTGTGCAGCGCGGACTCGATCC
ATTTCTGAGTGGAAGCGTTGCTCGCTAGCTTGTACCCTACTCGACACCGTTTCTTCTACTTGAGCCTGCATCCGAGACGAAAGAGGTGTTGTGGTTGATA
GTTGCGTAGTGTTGAAAGCATTCGAGTTGTACGGGTTTGAGATCTGGTGCGTGAGTGCTTCCTGCCGAAtctgttggagctggagagctACATCGGTTTG
CAACTTGGCCAATTGAGCGCTgcctgctgcaactcgatcTGTGAGCATATCCAGCCGAGCATCCAGCCTCGGGAGGGCACGTTCACACGCTTCAACTTTG
GCCGCCAAAAACTGCACCTGCGACGAGTTCTGTGCacaaaggcagcagcgtatAGTTAGTCTATGCGAATATCTATCAGAAAATACTACCCCACTAACGC
ACCCGCTCCTGTTGCTGAGTCTCCATGCGTGAGAGGAATTGTCCGAGCCGTAGCTCAAAATTGTGGCTCATACACTCGATGGTCTTGCTGACAATGAACT
CGACGTCAATGTGTTGCATCGGCAACGGTGCGACGGCATCTGGGCGTATTGTAGGAGAGATCGTGAGGCTGGGCTGTACTGGGTGCGCTTGAATGATCGC
AGTTGGCTTTCTCACTGTGTCGGACGCAACCGAGTGAAGAATGACTGAACCATTGGAACGAGGATATTCAGCATGTACAACTTGCCTTGGTAACGGAGAG
GTGGGCAGACCAGCAACGGAAGCTAAGGTGGCATTCACACTGGTCCTGGTCGCCACTGctacagcttccagctcagAACTCAATCGTAGTGTACTTGCAG
GATCCGTTGCTTTTGACTTTGGCGCCTGATCACTCGTATCGCGGACCGCGCAAGCTGATGTCGGTCGTCCAGCAAGTCGCGCGGAAACTGGTAAGTGGTC
GATGTGTGGGTCTGATTGAAAATCTAGGCGAAGATCTGGGAAATGTGTCCTGGCAACTTCTTTCAGGCATTCACATCCTTCTTTGTTTGTTTTGTCGttt
gcgtcttcatccagaGGAGATGAATTGTCATCCAAATAAAGCGTCTGCAAAGAACATTGCTGAcctgcagttgcagcttggagaAAACTGCGCTGTAACA
AATCCAGACTTTCCGCCGAGTTAAAACCGCAAGCTCGCAGGTCAAGCTCGCGTAGAGCACACTTGCCTGTTCTATCGCGGCGCCGGAAGAGTGAGCGGAC
AAGATCAAGTTTACCATCCTCCGAAAACGGATTCCCGAGCAGGCAAAGTGTCTCCAATGTGGAAGCGTTGCTAAGCAATACCGCGCCTACACCACCCTCG
ATTACATTGCCTGGTGCGCTCAAACATCGTactggaagctgcaccaAGGAGGCGAATCCAGCCGCTGTAATTCCATTGCGAGAAATGttcaactgctcca
gcattgGCCGGGATAAATATTCCTCCTGACCGATAGCAACTTCCACAGCTTTACCGCTCGACATGTTAAGCAGCTTCAATGCGTCCGCAATAGCACGTAA
GCCACCGTCACGAATGTTATTATCCGCCAGTATAAGATGGCGCAGGGAAGTGCAGGTTTGAAGTGACTGGCTTAAGATGATCCCAGCCTGCCGAGGAAGC
TTGCACGACGATAACTCCAATGTGACAAGCATCGAGGTGAAAAGTGTCGACATGGCAATGAGCGATGTCATGGTCACTTGCTGGCAGCTATGGTGTTCAG
AACACGCAGAATAATGTAAGCATCTAGCTTGACCAAGCGTGGACGTTAACTCACCTCCTTACGCGGAGATGCACCAGCTTAACTCGGTTTCTCGTTAATC
GGTCTGCCACTTTGGCGAAAAACCGATCCCCAGACAGCGTACACTTCTCCAATACCAAGCTTTGGCATTCCTGGCCGCAACCACCAACCAGCGAGTCCAG
CTGCTCATTGCTCAACTGATCAAGGCTAAagttgcgcagctccagacTCTTGATATCGGTGACTGGGTTCGTCAACGCGTCTTGCACAATGCGATCACTC
TGTAAAAGTTCAATTGACAGAAGACGTTAGCACGCTTGACAGTACTTACAAAATCTTGAGGAGGTCGTACCTTCGTCCGTACAATGCATGCCGGGGCGTC
CGTAGTCACTGCCACTGGAATGGCTTCTTCCTGTGATCCAATTGAAATTGCCCCAGCGTCGGCAACCTCCATCGCTCCTGCCCAAGAATGCTATAAAAAC
TCCCACGAAACCTGGCAAACACCAACGACTATTATTTTTGAGCAATACCATGAATGGCCTCCAACCGGCACCTCAACAACTCATCGTTGCAAAACCACTG
CAGTTTTTCTGCCATTGCTCGGCATGTGAAATACTACTCAAACTCGGCAGGATTACCAAACGGTGGTTCGGATACTTCCTTGAGGTCTTCAATATGGCTA
TCGCATCTGCTCTT