Description :
From Genome Similarity Track
Location :
Scaffold_131:52982- 54242
Transcript NameFunction/comments
g3023.t1RAW27698.1 hypothetical protein PC110_g15902 [Phytophthora cactorum

Sequence
1260 bases(100 bases per row)
TTCTGTGGCTCTAGCCTACTCCCCTCAAGTTTGCCAAAATGGATGAAAAGCACGATACAGTCAAATCTGTTTATATGATCCCTCCCTATTTGAGCCCCAA
CATTTGACTTGAATTTAGTAAGGCTGCTGCTTATTGTGATCACCAGCTTTTTTGCCTGTTCCAATTGTAAATCCATCGATTTATCGCCCGATTTATAATT
AGGAACCCAGATTTAGAATATAAATACGGCGCCTAACACTGAATTAGGACACATCACCCGGGTTTGCACTCATGATTGGGCTGCCATATTTAGCACGCGT
CTGGCGGATTTATTGGGGTGCAAGCGATTTATTTTTAAATCCTCCCAAATGCCCGAATGCAAATCGGCATTCGGGGAGTTGCGCATATATATATCGGCCA
CGTCGACTGACAGTCATGCTGATTCAAGTTGCTGTGAAGGTCGGAGACATAGGGCGATCAAGCAGAACAAATGTGCGTGTGGAGGATGGTAGGTTCCCGC
TCGACGACGAAAGCGAGGACTTTGGACAGCTCTGCGCCAAGGTTGATGAGCGCGTCTCCAGTGCGCTGCGGAACTATGAGCAGAAGGCCATCCGCCAGGA
CTCAAATCTCTACCTGAAGCCTGGCCTAACTGCTGCGCAGAAGGATTGGGTCTCGCTGACCGCCGATAACTGGATGGCCAAGATCGACATAGCGCGCAGC
AACTATTTGAAGCGCACGAAGGCTGGTGGACCATTCGTCGTTGAAGTGTTCGTCTTCGTCGCCAAGAAACAGCCCGGTATTCGGCGTGCCACCGCAAATC
GTGTCGAAGAGGCTTCCCGTGCAATTGACGACATACTGATTGAGCGACCCGACATTCAAGTCGGTGCTATTTCGCGCACTCACTGGGCCATGTCACATGC
ACGACAACCGGACGGGACGCTGCCGACAGTGCCGGACACGGCTACCTTCCGTCAAGCCCAGCACCTGGATGCAATGCGAGCGGCGCAGCAGCCGGACGAC
CGCGAAGAAGAGATCATGCGCACGCTTACCGTCAGCGTGAACGGCTCTACACCTCTGCAACTGACATTCAATGTCAACGATCTTCGAGCGCTGCTAGGAC
TTCCCGGGTACAACTTTCTGGCAGATGGCATCTTCTCCTCGTTCCAGCCCCCTTCGGAACCTGATGACGTTGAGGACACCGACCACACATAAACGGCAGG
AGCGGCATCTATTTTCTTAAGGAAATGCATCAACATGTATATTTTCCTTCTCGCTACGCT