Description :
From Genome Similarity Track
Location :
Scaffold_407:5298- 9304
Sequence
4006 bases(100 bases per row)
GTCGCGCAGATACTTGTGCTGCACGTCGTTATGCTTGGCCTTGATCAAGGAGGCTTCGCCTTCTATCTGGATGATTGCTGCCAGGTTGTCTACGTGCATT
ATCATACGGAAAACCGGCGCCATGCCCACTTCTCCGAGCATCTGGTGTAAGCCAATGAGCTCGCGCGCGACCTCCGACGCCGCGACGAACTCGGCCTCCA
TCGTCGAGAGGCTCACACCGCCCTGTTTCTTTGCGGTCCACAACACCACTATCCCATTGAGGAGCACGACGTCTCCCGTTAGCGACTCCGGTCCGATTTG
TCAGCTGCGAAGTCGGCGTCCCTGTAGGCTTCGAGCTACAGCCCGTCACGACTCGTTCGCGCCGGTGCCATCTCGAGCTTGAGCGTCGCGGTGCCCTTGA
GGTACCACCCGACACGCTTGGCGAGCTTTCAGTCGATAATCCGCGGCGCATGCGTCTGCCTAGTCGCTTTGTGCACTGCAAAGGCAATGTACGGCCTCGA
GCACCGCGCGACCCACAGTAGGCTCCCGACGAGCGATTGGAACGCGTTGATGGTCGCACCACCACCTGCGCTCGTCGTTACCAGCAGCGCGGTGTCGTCA
TCTACTACCTCGTAGCAGTCGTCTCCAATCGGCGTCTTCTTCGGGTTTGCATCGCTCATCCCATGGGCACGCGGAAGCTCCTTGGTGGCCTCCTCCTGGT
CGATGCGGTACGCGCCGTCGCTTCCGAGCTCCACTCGCATCCTTAGGAACTTGTGGACGTGACAGAGATCCTTGATCGACTGCGGCGCCAGGCTCGAGAA
GAAGCTCTCGACCGCCGCGACGCTCTTCCCGTCGCCAGCAGATCGTCGACGTAGACGCGGACAACGACCATCTCTTTGCCATCGCGCTTGTAGTACAGAC
ACATGTCTGACGCGCAGCGCACGTACCCCGCATCGCTGAGTCGCGTATGGAGCAACTGGCTCCAGAGGCGCCCGGCTTGCTTCAGCCCGTATAGGCACCT
CCGCAGCTTCAAGACGTCCTCGCCTGGATGCGTAGCGCCGATCTTGCGCAGAGTGCTCTCCGACACGGTCATACCGCGTGGCACCTGCAAGCAGATGTCG
AGTTGTGCTTCCTTTTCGGCACGCACGTATGCGTTCGGGATGTCCCCGTGCTCATCCGTCACGCCCCACGTTGCTGCGAGCACAAGCACGACCTTTTCTG
TCGCGATATCCATCATGGTGACAAAGGTCATATTGTAATCAACTCCGATCACTTTCTCATTGCCGCATGCGACAAGACTCGCCTTGTGTCTCTCGAGCTC
TCCATCGGCTCCAGGCTTGGTCTGAAAGACCCACTTGGAGTGAAAAGCTTTCCCGCACGGACTGCGCTTCGTAACGCGCCACACGTCGTTGGTCTCGAGC
GCGGCGATCTTCTCTTGCATCGCCGTCTGCGATTCCGCGCGCTTCCAGCTGCGCATGGCCTCGTTATAGGTGCGTGGATCGATCGCGAGCAAGCACCTGG
GCTGACCATCTCGTCGCTCGCTGCTCGTTCCTCCTGACACGAAAGTTCTTGCTCTTCTCGCGAATGCCACGACCATCTTGCACTCCTTCGTTGTCGTAGC
GGGTCGCCACTGGCGCATCTACCGCTGGCGATGTCTCCTTCGCTTCTTCGTATGACCTTCGACCTTCATCGCGCGCTGCTGTTGCGCGTTCTGCGCATCG
CAAAGTGTGGAGATGTTCTTCACGTGTTGTGTGACGACCACCTTGTTCACTCGCTGGAGGAGGATATTGTACCTCTTCGTCTCCTTGCTCACGCCCACGA
TGATGCCTGTCTACGATCGCTGCTGCAGCGAGCTCTTGTGCGGGTCGCGGTAGACGCTACACGACTATCCGAAGACGACGATGCTGCGCAGATCTGGCGC
CTTGCCCGTCAGCACCGCGATAGTCGACGCTTTCTTCGCTCTCGCTCGCGTCGGACTGCGGTTTAAGTGTGGACGGCGTACTGCACCGCATCGCCCCAGA
ATTACAACGGCAGCGCGCACGCGAACATCATGCTGCACGCGAGGTTTAAAACGATTCGGTGAATCCTCTCTGCCTTGCTGCTCGATGCCTGGTTGCGCGC
TTCTAACGCTTGGCGCGGGACACCCGTGCGATTGCAGAACAAGTCAACGTTGGCGTAGGCGCCACCGCTGTCTGTTCGCAGCACGTGGACCTTGAAGCCG
AAGGGCTTCGAAAAGTGGACGAGGAATGGCTCAAAATGCGTCGCCGCCGCGTCCTTCGTGCGCGCGAGGAACACGCGGCAGTAGTTCGACTTGTGGACGA
TAAAGTTGACCAGATATCGATTGCCGAGGCGATCCTGCGGCATCATCAGGCGCTTAAGATCCGAGCAGATGCCGATCCCGTTGATTCGCGAGTTGGCACC
GCTGTCTTGCTGCGACTGCGCGTTGCGCGTCTGATTGTCCTCGAGACACGCACGCACGCCATGCCCTTCTTGATGGTCAGTCGGATGCCCGACTCCCGAT
CGCGCGCCATACGCACAATCGTATCGAACGCGATCTGGTCTAGTCGCTAGTGCCAGTGCAGCAGCGAGGCTTCTTGCATGCCGTCCGCATCAGCATCCAT
CACAGGCTCTTCGAGCGAGGCCATGATCGCATCTCCAGCGCTGTGCTTCCCTCATGTCGCTGTAGTCTCGACGTACAACACGTTGCTGTCGATCGCAGCG
TCGAACGCTACTGTACCGTCGCTGCGCCGCGCTAGCTCGGGTTTGTTGCCGTCGTACACGAGGGCAAACCCTTTGCACTCTAGATTTCCGTACGAGACGA
TGTTCTTCGCCAGACGCGGCGTAAGATAGACTTCGCTTAGCGTCACAGTCATCTTCATACCGCGCACGAGGACCTCGAGACGCACACTCCCGACACGCGT
CAGCCGCAGCGACTCACCATCTGCCATGGCGATCTCGTGGACGCAGGCATCTGAGTCGATCAACAGCGACTCGTCGTTAACGAGGTGTCTGCTCGCACCG
CTGTCGAGGATCCAGTCGCCTCGATCGATGCTTATTGCATCGTTTGTGGCTAGCACAAAGCCCTTCACGTAGCTCGCAGCTCGCGCTTTGTCGCTCGCAC
GATCCGCTTTGACTCGCAAGTTCTTCTTCTTCTTTCGTTTGGCTCCTTTCGTGCGATCTGCTGACGTTTTCTCCATGAGCGAAAGCACGATGTCGCCGCT
CGTGTTGATCGTCTCGTCGTCAAACACGACCCTTGCTTTGCAGTCGGACAAGACGTGCCCCATCCTGCCGCAGCGGAAACACGTTCGTGTGTCTTGGCAC
TTCGTCTCGACATGCGCCGCAACGACCTCGCGACCGATCGCGCCACTACCGAGCTTGATAGACTGCGCAAAGTGCGCCAACTACTCAGCGTGGCACAGGC
AGTCGAACCTCGTCGGGTCATACTTCGCCCGCATGACATTCATCACCTCTAGCGACGCGTAATGCACGATGTTGTCGAGCACAAGCGAGTCGGCACCACC
GCGCGCGTCGCTGACGGCCACCATGTATAGAAAGTGCTCTTCCCAGGTGCGTCGTGCTTCTTTCTTTGTCATGAACAGCTTCATGGCCTGGCTCGCCGTG
ATCTTCGTTTTGAACGTCAGGTGGTGCTGCTCCATGACGTGCTTTAGTCTCGGCTGCTGCACCCACCAAGTTTCGACCTGTTTGTGATAGTATCGCTCCG
CAATACCGGCCAAGAAGTGACCGAGGCGGTCGATCTTCACGTCCTCCGCCCACAAGAAACCGAACAACGCCTCACCGAGGCTCACGGCGCGCATTAAGGT
GCGTCCCCAGTCAAAGAACCCTCTCCCGAGCCCTTTGTAGAGCTCCGTCCCATCAAACTTACGAATGTCGAGCTTTCGCTGACTCGCGGTCGGCATTCCG
TAGTTGCCGATTGATGCCGCCGTGTGCGTCGCAGGTGGCGGCGCGGCCATGGGCTCGGTTGCTCGTGCCGGCAATTGATGCTGAGCTGGCAGCTGTCGTT
GCGGCG