Description :
From Genome Similarity Track
Location :
Scaffold_1328:5298- 6997
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1328-snap-gene-0.10Function: syntaxins are involved in intracellular vesicle trafficking
Pytul_var.sporangiiferummaker-pug3_contig_1328-fgenesh-gene-0.4Mitochondrial Protein Translocase (MPT) Family

Sequence
1699 bases(100 bases per row)
CTAACTCCCCGCGACCAACAGGAAAATCAAAATGGCAAACAGGATGATAATAATAACATAGAGCTTGAAGTTGTTGCTCTGGCGCGCCACCTATGTATGA
ATAATACACGCAACGTCAATTGCCACATGGGAAGATCATCAATAAAACCATAAGCAAAGCACCTCGTACCTTTGCAGCGCGTTCACCTTCGGACTCGAGA
CCATTCGTGGCGCGCGACACGTCGTCGTCAATGTCGTTCAGCAAGCGCACGTGGAGCTCCGTTTCATCCTTCACAGTGAGACTGTAGTTCTTCAAATTGG
ACACACCGCGGCCAATCAGATCCAATTGCTGGTCTTGATCTGCACAGCATAACAAAGCAAATGAGGTCAGTATTTTGCGCTGCATGGGTTCACACACAGC
ACGTCAAGCTTATTGGCTCGTACCTTTCATAATCTGGTTTTGCATACTGAGCAGCTGTCGTGGCTGCTCTCGNNNNNNNNNNNNNNNNNNNNNNNTACAA
ACGTAAGGAACACAAACACACATATATTAGACAAGATTGACAAAAAAACGCATATGACCTCTCGCATGCATACCTCGCGGCTGGACTGTTACGTCTGTTG
TACGAGTCCAAATCGTTTTTCTACAATCATAGCAATACCCATAAAGCAACCATCAACACCAGCGTGCTCACAATATCCATGCAAGCGCGCATACTCATAT
CCAACGTACCAGATCTTGATCCAATTGCCTCAATAAACGCTCTCGCCGATCGAGTTCCTGCTTCGTGCTACATTAATGGAAGCAAACGACACGATGAGTA
CCCATTTTGCAACACAACACAAAACACCACGTAATACAGCCTGCAGCGCATGCGTCTGCAAAACGTACACACTCGACGTCGTCGACCGCATGAGTTGCTC
AAAGTCGCGCTTGAGCCGCGATGTGCTCTGTTGCAGCGCAAACACGCTCGTGCCGATGGCCGCGACGTTGCCGGCGCGGATCTTGGCGGCGATCATGGTC
TCCTGGCCGCGCGCATTCTCGAGTCGGTCCAACCAGCTCGCCCACGCCGCTGCGCTCATCCTTGTCTTCTGTTACGTGCTGCTTTCCTTTAAGCGCGTTT
TCCCAGAGCCACTCCCCCACACACGCGCGCGCACTCGTGCCAATGTGCTGGATCGCTTTGTTCTCTTTCTTCCAATATTTTCGAAGGGACTCCCGCTTGA
AGGAATCAGGATCCCTTGTTAGAGTAGCGCAATCCCTATTTTAATTATTTTCGGGATAGAGGCCGGCAATTTTAAGGATCCGCGGGATTCTCGTGGGCTT
GCAAATTCGGGACGTGTTGCGAAACCCAATCAATCACCGATACAAACGCGGCGGAAAAGTTACGAAGCACGAAAGCAAGCACGAAGGCAGTCAATATGAG
TCTCCAGCAACGCGAGTTCGAGCGCAAGATGGAAGAGCACATGGAGGAGATGCGCGTGTCGCAGACCATCGCGTACTTCAACCGCACGGTGGAGCTCTGC
TTCAGCGAGTGCGTGCACTCGTTCCGCAGCAAGAAGATGGACGACGCCGAAGCGTCGTGCGTCAACAACTGCGCCGAAAAGTTCCTCCGCTACACCATGC
GCTCGTCGGTGCGACTGCAAGAGAGCTACGCCGACATCATGGAGAAGCAGCAGCAGCAACAGCAGTAGAAGATGAGGAGTGGCGACGAGCCGACAGAGA